• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    the present invention relates to a combination product and its use in therapy.
    公开号:BR112019021910A2
    申请号:R112019021910-2
    申请日:2018-04-18
    公开日:2020-05-26
    发明作者:Walczak Robert；Belanger Carole；Legry Vanessa；Noel Benoît；Descamps Emeline；Vidal Guillaume；Walczak Mathilde
    申请人:Genfit；
    IPC主号:
    专利说明:

    COMBINATION OF ELAFIBRANOR OR DERIVATIVES OF THE SAME WITH AN ANTI-NASH, ANTIFIBROTIC OR ANTICOLESTATIC AGENT
    [0001] The present invention relates to a combination therapy for the treatment of inflammatory, metabolic, fibrotic and cholestatic diseases.
    [0002] 1- [4-Methylthiophenyl] -3- [3,5-dimethyl-4carboxidimethylmethyloxyphenyl] prop-2-en-l-one (Elafibranor, or ELA previously called GFT505), disclosed in document W02004005233, has properties that can be advantageous for the treatment of various gastroenterological diseases and liver diseases, in particular cholestatic diseases, such as PBC (primary biliary cholangitis) and PSC (primary sclerosing cholangitis), or liver diseases, in particular, non-alcoholic fatty liver diseases (NAFLD), as non-alcoholic steatohepatitis (NASH).
    [0003] El afibranor was tested for clinical efficacy for NASH in a Phase 2b test based on 1-year liver biopsy (GFT505-212-7), one of the largest interventional studies ever conducted for NASH. Administered to more than 800 healthy patients and volunteers to date, elafibranor has shown beneficial properties for NASH, including, in particular: improvement of liver dysfunction markers, including ALAT, ASAT, yGT, ALP; improvement in insulin sensitivity and glucose homeostasis; favorable effects on plasma lipids, including decreased plasma triglycerides and LDLC, and increased HDL-C levels; anti-inflammatory properties; effectiveness in histological NASH parameters
    Petition 870190105365, of 10/18/2019, p. 21/148
    2/102 (steatosis, inflammation, fibrosis) in animal disease models and antifibrotic activities. The absence of safety concerns has been confirmed in a complete toxicological package in carcinogenicity studies of up to 2 years. Elafibranor is currently being evaluated in a phase 3 clinical study for the treatment of NASH. The evaluation of this molecule for the treatment of PBC in a phase 2 clinical study is also planned.
    [0004] In view of this excellent therapeutic or pharmacological profile, elafibranor is a very promising molecule that can potentially be used in combined pharmacological approaches to target complementary or parallel key trajectories involved in a high number of inflammatory, metabolic, fibrotic and cholestatic diseases .
    SUMMARY OF THE INVENTION
    [0005] The present invention relates to a combination product comprising:
    (I) a PPAR agonist, in particular, a compound of formula (I), or a pharmaceutically acceptable salt thereof:
    (i) where:
    Y1 represents a halogen, a group Ra or Ga-Ra;
    A represents a CH = CH group or a CH2-CH2 group;
    Petition 870190105365, of 10/18/2019, p. 22/148
    3/102
    Y2 represents a Gb-Rb group;
    Ga and Gb, identical or different, represent an oxygen or sulfur atom;
    Ra represents a hydrogen atom, an unsubstituted (C1-C6) alkyl group, a (C6-C14) aryl group or a (C1-C6) alkyl group that is replaced by one or more halogen atoms, a (C1 -C6) alkoxy or a (C1-C6) alkylthio group, (C3-C14) cycloalkyl groups, (C3-C14) cycloalkylthio groups or heterocyclic groups;
    Rb represents a (C1-C6) alkyl group substituted by at least one -COORc group, where Rc represents a hydrogen atom or a (C1-C6) alkyl group which is substituted or not by one or more halogen atoms, groups (C3-C14) cycloalkyl or heterocyclic groups; and Y4 and Y5, identical or different, which represent a (C1-C6) alkyl group which is or is not substituted by one or more halogen atoms, (C3-C14) cycloalkyl groups or heterocyclic groups. and (ii) an anti-NASH, antifibrotic or anti-cholestatic agent.
    In a particular embodiment of the compound of formula (I): Y1 represents a halogen, a Ra or a Ga-Ra group; A represents a CH = CH group;
    Y2 represents a Gb-Rb group;
    Ga and Gb, identical or different, represent an oxygen or sulfur atom;
    Ra represents a (C1-C6) alkyl or (C3C14) cycloalkyl group, in particular a (C1-C6) alkyl group or (C3-C14) cycloalkyl substituted or not by one or more
    Petition 870190105365, of 10/18/2019, p. 23/148
    4/102 halogen atoms;
    Rb represents a (C1-C6) alkyl group substituted by a -COOR3 group, where Rc represents a hydrogen atom or an alkyl group having one to four carbon atoms; and
    Y4 and Y5, independently, represent a (C1 -C4) alkyl group.
    [0006] In a particular embodiment of the compound of formula (I):
    Y1 represents an Ra or Ga-Ra group;
    A represents a CH2-CH2 group;
    Y2 represents a Gb-Rb group;
    Ga represents an oxygen or sulfur atom and Gb represents an oxygen atom;
    Ra represents a (C1-C6) alkyl or (C3C14) cycloalkyl group;
    Rb represents a (C1-C6) alkyl group substituted by at least one -COORc group, where Rc represents a hydrogen atom or (C1-C4) alkyl group; and
    Y4 and Y5, independently, represent a (C1 -C4) alkyl group.
    In a particular embodiment of the compound of formula (I):
    Y1 represents a hydrogen atom or a Ra or Ga-Ra group;
    A represents a CH2-CH2 group;
    Y2 represents a Gb-Rb group;
    Ga represents an oxygen or sulfur atom and Gb represents an oxygen atom;
    Ra represents a (C1-C6) alkyl or (C3C14) cycloalkyl group that is replaced by one or more atoms
    Petition 870190105365, of 10/18/2019, p. 24/148
    5/102 halogen;
    Rb represents a (C1-C6) aiquyl group substituted or not by one or more halogen atoms and replaced by at least one -COORc group, where Rc represents a hydrogen atom or a (C1-C4) aiquyl group; and Y4 and Y5 represent an alkyl group (C1-C4).
    [0007] In a particular embodiment of the compound of formula (I), Gb is an oxygen atom and Rb is a group (Cl - C6) aiquila substituted by a -COORc group, where Rc represents a hydrogen atom or a group ( Cl— 04) straight or branched unsubstituted aiquila.
    [0008] In a particular embodiment of the compound of the formula (I), Y1 is a (C1-C6) alkylthio group comprising an (C1-C6) alkyl group which is linear or branched which is substituted or not by one or more atoms of halogen.
    [0009] In a particular embodiment, the compound of formula (I) is selected from the group consisting of 1— [4 - methylthiophenyl] -3- [3,5-dimethyl-4carboxidimethylmethyloxyphenyl] prop-2-en-l-one (Elafibranor or GFT505), 1- [4-methylthiophenyl] -3- [3,5-dimethyl-4-isopropyloxy carbonyldimethylmethyloxyphenyl] prop-2-en-l-one, 1- [4methyltophenyl] -3- [3,5 -dimethyl-4-tercbutyloxycarbonyldimethylmethyloxyphenyl] prop-2-en-l-one, 1 [4-trifluoromethylphenyl] -3- [3,5-dimethyl-4-tercbutyloxycarbonyl dimethylmethyloxyphenyl] prop- -2-en-l-one, 1 [4-trifluoromethylphenyl] -3- [3,5-dimethyl-4carboxidimethylmethyloxyphenyl] prop-2-en-l-one, 1- [4trifluoromethyl oxyphenyl] -3- [3,5-dimethyl-4-tertbutyloxycarbonildimethylmethyloxyphenyl] prop- 2-en-1-one, 1 [4-trifluoromethyloxyphenyl] -3- [3,5-dimethyl-4
    Petition 870190105365, of 10/18/2019, p. 25/148
    6/102 carboxidimethylmethyl oxyphenyl] prop-2-en-l-one, 2- [2,6dimethyl-4- [3- [4- (methylthio) phenyl] -3-oxo-propyl] phenoxy] -2methylpropanoic acid and ester 2- [2,6dimethyl-4- [3- [4- (methylthio) phenyl] -3-oxo-propyl] phenoxy] -2-methyl-propanoic acid isopropyl.
    [0010] In a particular embodiment of the invention, component (ii) is an anti-NASH agent. Non-limiting, illustrative antiNASH agents useful in the practice of the present invention include:
    - Acetyl-CoA carboxylase inhibitors;
    - A3 adenosine receptor agonists;
    - Aldosterone antagonists and mineralocorticoid antagonists
    - AMP-activated protein kinase stimulator
    - Amylin receptor agonist and calcitonin receptor agonists;
    - Angiopoietin-related protein 3 inhibitors
    - Anti-LPS antibodies;
    - Apical sodium codependent bile acid transporter inhibitors;
    - Anhydrous betaine or RM-003;
    - bioactive lipids;
    - Cannabinoid CB1 receptor antagonists;
    - CB1 double cannabinoid receptor / iNOS inhibitor, caspase inhibitors;
    - Cathepsin inhibitors;
    - CCR antagonists;
    - CCR3 chemokine modulators and eotaxin 2 ligand inhibitors
    - Diacylglycerol-O-acyltransferase inhibitors (DGAT)
    Petition 870190105365, of 10/18/2019, p. 26/148
    7/102
    - Dipeptidyl peptidase IV (DPP4) inhibitors;
    - Insulin receptor agonists and insulin ligand;
    - MCH receptor 1 antagonist and insulin sensitizers
    - NOX inhibitors (NADPH oxidase), as NOX 1 and double 4 inhibitors;
    - Extracellular matrix protein modulators;
    - Stearoyl CoA desaturase-1 inhibitors / fatty acid bile acid conjugates (FABAC);
    - Fatty Acid Synthase Inhibitors (FAS)
    - Growth Factor receptor binders
    Fibroblast 19 (FGF-19), as a Factor protein
    Growth of Recombinant Fibroblast 19 (FGF-19) or functional manipulated variant of the FGF-19 protein;
    - Growth Factor receptor binders
    Fibroblast 21 (FGF-21), as a Factor protein
    Growth of Fibroblast 21 (FGF-21) or functional manipulated variant of the FGF-21 protein;
    - Farnesoid X receptor agonists (FXR);
    - Galectin 3 inhibitors;
    - Glucagon-like Peptide-1 analogues (GLP-1) and GLP-1 receptor analogues;
    - G protein-coupled receptor modulators (GPCR);
    - Receptor 84 antagonist coupled to G protein, connective tissue growth factor inhibitor and free fatty acid receptor 1 agonists,
    - Cell Hedgehog signaling path inhibitors
    - Integrin inhibitors;
    - Ketohexokinase inhibitors, Leukotriene inhibitors
    Petition 870190105365, of 10/18/2019, p. 27/148
    8/102 (LT) / Phosphodiesterase (PDE) / lipoxygenase (LO);
    - Inhibitors homologous to lysyl oxidase 2 (LOXL2 inhibitors);
    - Macrolides;
    - Methyl-CpG-binding protein 2 modulator and transglutaminase inhibitors;
    - miRNA antagonists,
    - Mitochondrial carrier family inhibitor and Mitochondrial phosphate carrier protein inhibitor
    - Monoclonal antibodies;
    - Myeloperoxidase inhibitors;
    - mTOR modulators;
    - NAD-dependent deacetylase sirtuin stimulator; PDE inhibitor 5
    - Nicotinic Acid Receptor Agonists (GPR109)
    - Nuclear receptor ligands;
    - P2Y13 protein agonist;
    - Phenylalanine hydroxylase stimulators;
    - Protease activated receptor (PAR) -2 antagonists;
    - Protein kinase modulators;
    - Agonists in PPAR-alpha; - Agonists in PPAR-gamma; - Agonists in PPAR-delta; - Agonists in PPAR-alpha / gamma; - Agonists in PPAR-alpha / delta;
    - PPAR-gamma / delta;
    - PPAR-alpha / gamma / delta agonists or panPPAR agonists;
    - Rho-associated protein kinase 2 inhibitors (ROCK2);
    Petition 870190105365, of 10/18/2019, p. 28/148
    9/102
    - Sodium-Glucose Transport Inhibitors (SGLT) 1;
    - Sodium-glucose transport inhibitors (SGLT) 2;
    - Stearoyl-CoA desaturase-1 inhibitors;
    - Signal regulation kinase 1 inhibitors (ASK1);
    - Thyroid β receptor agonist (THR β);
    - Toll-like Receptor 2 antagonists (TLR-2);
    - Toll-like Receptor 4 antagonists (TLR-4);
    - Type I natural killer T cell inhibitors;
    - Tyrosine kinase receptor (RTK) modulators;
    - Urate 1 anion exchanger inhibitors and Xanthine oxidase inhibitors;
    - Vascular adhesion protein-1 inhibitors (VAP-1) and
    - Vitamin D receptor agonist (VDR).
    [0011] In an additionally particular embodiment of the invention, component (ii) is an anti-NASH agent.
    [0012] in another particular modality, the anti-NASH agent is selected from:
    - Acetyl-CoA carboxylase inhibitors;
    - Anti-LPS antibodies;
    - Apical sodium codependent bile acid transporter inhibitors;
    - bioactive lipids;
    - Cannabinoid CB1 receptor antagonists;
    - Double cannabinoid iNOS inhibitor / CB1 receptor
    - Caspase inhibitors;
    - Cathepsin inhibitors;
    - CCR antagonists;
    - Diacylglycerol-O-acyltransferase inhibitors (DGAT)
    - Dipeptidyl peptidase IV (DPP4) inhibitors;
    Petition 870190105365, of 10/18/2019, p. 29/148
    10/102
    - NOX inhibitors (NADPH oxidase), as NOX 1 and double 4 inhibitors;
    - Extracellular matrix protein modulators;
    - Stearoyl CoA desaturase-1 inhibitors / fatty acid bile acid conjugates (FABAC);
    - Growth Factor receptor binders
    Fibroblast 19 (FGF-19), as a Factor protein
    Growth of Recombinant Fibroblast 19 (FGF-19) or functional manipulated variant of the FGF-19 protein;
    Fibroblast Growth Factor 21 (FGF-21) receptor ligands, as Fibroblast Growth Factor 21 protein (FGF-21) or engineered functional variant of the FGF-21 protein;
    - Farnesoid X receptor agonists (FXR);
    - Galectin 3 inhibitors;
    - Glucagon-like peptide-1 analogs (GLP-1);
    - G protein-coupled receptor modulators (GPCR);
    - Integrin inhibitors;
    - Leukotriene (LT) / phosphodiesterase (PDE) / lipoxygenase (LO) inhibitors;
    - Macrolides;
    - miRNA antagonists,
    - Monoclonal antibodies; mTOR modulators;
    - Nuclear receptor ligands;
    - P2Y13 protein agonist;
    - Protease activated receptor (PAR) -2 antagonists;
    - Protein kinase modulators;
    - PPAR-alpha agonists;
    - PPAR-gamma agonists;
    - PPAR-delta agonists;
    Petition 870190105365, of 10/18/2019, p. 30/148
    10/112
    - PPAR-alpha / gamma agonists;
    - PPAR-alpha / delta agonists;
    - PPAR-gamma / delta;
    - PPAR-alpha / gamma / delta agonists or panPPAR agonists;
    - Rho-associated protein kinase 2 inhibitors (ROCK2);
    - Sodium-glucose transport inhibitors (SGLT) 2;
    - Signal regulation kinase 1 inhibitors (ASK1);
    - Thyroid β receptor agonist (THR β);
    - Toll-like Receptor 4 antagonists (TLR-4);
    - Tyrosine kinase receptor (RTK) modulators;
    - Vascular adhesion protein-1 inhibitors (VAP-1); and
    - Vitamin D receptor agonist (VDR).
    [0013] Other anti-NASH agents include KB-GE-001 and NGM386 and NGM-395, NC-10 and TCM-606F. Additional anti-NASH agents include icosabutate, NC-101, NAIA-101, colesevelam and PRC-4016.
    [0014] In a particular embodiment of the invention, component (ii) is an antifibrotic agent. Illustrative, non-limiting antifibrotic agents useful in the practice of the present invention include:
    - A3 adenosine receptor agonists
    - Angiotensin II receptor blockers
    - Growth factor beta 2 for the transformation of antisense oligonucleotide targeting (Τ6Ε-β2);
    - Bioactive lipids;
    - Caspase inhibitors;
    - Cannabinoid CB2 receptor mimetics;
    - Farnesoid X Dual Receptor (FXR) / TGR5 agonists;
    Petition 870190105365, of 10/18/2019, p. 31/148
    10/122
    - NOX inhibitors (NADPH oxidase), as NOX 1 and double 4 inhibitors;
    - Galectin 3 inhibitors;
    - Cell Hedgehog signaling path inhibitors
    - Immunomodulators;
    - Integrin inhibitors;
    - Modulators of the macrophage mannose receptor;
    - Metalloproteinase-9 stimulators (MMP-9);
    - Monoclonal antibodies;
    - NF-kappa B inhibitors;
    - Non-steroidal anti-inflammatory drugs (NSAIDs)
    - PDGFR modulators;
    - Agonists in PPAR-alpha; - Agonists in PPAR-gamma; - Agonists in PPAR-delta; - Agonists in PPAR-alpha / gamma; - Agonists in PPAR-alpha / delta;
    - PPAR-gamma / delta; and
    - PPAR-alpha / gamma / delta agonists or panPPAR agonists.
    [0015] In an additional particular mode, the antifibrotic agent is selected from the group consisting of:
    - Beta 2 Growth Factor for transforming antisense oligonucleotides (TGF-p2);
    - Bioactive lipids;
    - Caspase inhibitors;
    - Cannabinoid CB2 receptor mimetics;
    - Farnesoid X Dual Receptor (FXR) / TGR5 agonists;
    - NOX inhibitors (NADPH oxidase), as NOX inhibitors
    Petition 870190105365, of 10/18/2019, p. 32/148
    13/102 and 4 double;
    - Galectin 3 inhibitors;
    - Immunomodulators;
    - Integrin inhibitors;
    - Modulators of the macrophage mannose receptor;
    - Metalloproteinase-9 stimulators (MMP-9);
    - Monoclonal antibodies;
    - NF-kappa B inhibitors;
    - Non-steroidal anti-inflammatory drugs (NSAIDs)
    - PDGFR modulators;
    - Agonists in PPAR-alpha; - Agonists in PPAR-gamma; - Agonists in PPAR-delta; - Agonists in PPAR-alpha / gamma; - Agonists in PPAR-alpha / delta;
    - PPAR-gamma / delta; and
    - PPAR-alpha / gamma / delta agonists or panPPAR agonists.
    [0016] Other antifibrotic agents include HEC-585, INV-240, RNAi therapeutic agent (Silence Therapeutics) and SAMiRNA program (Bioneer Corp).
    [0017] Other illustrative antifibrotic agents include tyrosine kinase or pirfenidone receptor inhibitors (RTKIs), such as Nintedanib, Sorafenib and other RTKIs or angiotensin II receptor blockers (ATI) or CTGF inhibitor or any antifibrotic compound susceptible to interference with trajectories activated by TGFp and BMP including activators of the latent TGFp complex, such as MMP2, MMP9, THBS1 or cell surface integrins, type I (TGFBRI) or type II TGFp receptors
    Petition 870190105365, of 10/18/2019, p. 33/148
    14/102 (TGFBRII) and its ligands, such as TGFp, Activin, inhibin, Nodal, anti-Müllerian hormone, GDFs or BMPs, auxiliary co-receptors (also known as type III receptors) or components of SMAD-dependent canonical trajectories including members or SMAD proteins regulating or inhibiting non-canonical or SMAD-independent pathways including various MAPK, TAK1 signaling branches, Rho-like GTPase signaling pathways, phosphatidylinositol-3 kinase / AKT pathways, TGFp-induced EMT process or pathways canonical and non-canonical Hedgehog signaling including Hh ligands or target genes or any members of the WNT or Notch trajectories that are likely to influence TGFp.
    [0018] In a particular embodiment of the invention, component (ii) is an anti-cholestatic agent. Non-limiting, illustrative anti-cholestatic agents useful in the practice of the present invention include:
    - apical sodium codependent bile acid transporter inhibitors (ASBTi);
    - Bile acids; cathepsin inhibitors;
    - OCR antagonists;
    - CD40 inhibitors;
    - CD80 inhibitors;
    - NOX inhibitors (NADPH oxidase), as NOX 1 and double 4 inhibitors;
    - Farnesoid X receptor agonists (FXR);
    - Recombinant Fibroblast Growth Factor (FGF) 19;
    - Fractalquin ligand inhibitors;
    Petition 870190105365, of 10/18/2019, p. 34/148
    10/152
    - ileo sodium bile acid cotransporter inhibitors;
    - Monoclonal antibodies;
    - Agonists in PPAR-alpha; - Agonists in PPAR-gamma; - Agonists in PPAR-delta; - Agonists in PPAR-alpha / gamma; - Agonists in PPAR-alpha / delta;
    - PPAR-gamma / delta; and
    - PPAR-alpha / gamma / delta agonists or panPPAR agonists.
    [0019] In a particular modality, the anti-cholestatic agent is selected from the group consisting of:
    - apical sodium codependent bile acid transporter inhibitors (ASBTi);
    - Bile acids; cathepsin inhibitors;
    - CCR antagonists;
    - CD40 inhibitors;
    - CD80 inhibitors;
    - NOX inhibitors (NADPH oxidase);
    - Farnesoid X receptor agonists (FXR);
    - Recombinant Fibroblast Growth Factor (FGF) 19;
    - Fractalquin ligand inhibitors;
    - ileo sodium bile acid cotransporter inhibitors;
    - Monoclonal antibodies;
    - PPAR-alpha agonists;
    - PPAR-gamma agonists;
    - PPAR-delta agonists;
    Petition 870190105365, of 10/18/2019, p. 35/148
    10/162
    - PPAR-alpha / gamma agonists;
    - PPAR-alpha / delta agonists;
    - PPAR-gamma / delta;
    - PPAR-alpha / gamma / delta agonists or panPPAR agonists;
    Illustrative acetyl-CoA carboxylase inhibitors include, but are not limited to, GS-0976, ND-654, AC-8632, PF05221304, CP640186, Gemcabeno, MK-4074 and PF05175157.
    [0021] Illustrative A3 adenosine receptor agonists include, but are not limited to, 2- (1-hexynyl) -Nomethyladenosine, Piclidenoson CF-101 (IB-MECA), Namodenoson CF-102, 2-CI-IB-MECA, CP-532,903, Inosina, LUF-6000 and MRS3558.
    [0022] Illustrative aldosterone antagonists and mineralocorticoid receptor antagonists include, but are not limited to, Apararenone (MT 3995), Amiiloride, Spironolactone, Eplerenone, Canrenone and potassium canrenoate, progesterone, drospirenone, gestodene and benidipine.
    Illustrative AMP-activated protein kinase stimulators include, but are not limited to, PXL-770, MB-11055 Debio-0930B metformin, CNX-012, 0-304, mangiferin calcium salt, eltrombopag, carotuximab and imeglimine.
    The illustrative amylin receptor agonist and calcitonin receptor agonists include, but are not limited to, KBP-042 and KBP-089.
    [0025] Illustrative angiopoietin-related protein 3 inhibitors include, but are not limited to,
    Petition 870190105365, of 10/18/2019, p. 36/148
    10/172
    ARO- ANG3, IONIS-ANGGPTL3-LRX or AKCEA-ANGPTL3LRX, evinacumab and ALN-ANG.
    [0026] According to the invention, the term angiotensin type 1 receptor antagonists as used herein includes, but is not limited to, Irbesartan.
    [0027] According to the invention, the term anti-LPS antibodies as used herein includes, but is not limited to, IMM-124-E.
    [0028] The antisense oligonucleotide targeting transformation beta 2 growth factor includes, but is not limited to, ASPH-0047, IMC-TR1 and ISTH-0047.
    [0029] The illustrative apical sodium codependent bile acid transporter inhibitor includes, but is not limited to, A-4250, volixibat, previously known maralixibat SHP-625, GSK-2330672, elobixibat and CJ-14199.
    [0030] Illustrative bile acids include, but are not limited to, obeticolic acid (OCA) and UDCA, norursodeoxycholic acid and ursodiol.
    [0031] Illustrative bioactive lipids include, but are not limited to, 5-hydroxyeicosapentaenoic acid (15-HEPE, DS-102).
    [0032] In an additionally particular modality, the bioactive lipid can be selected from unsaturated fatty acids, such as arachidonic acid 25, icosapentaethyl ester, eicosapentaenoic acid and docosahexaenoic acid.
    [0033] Illustrative cannabinoid CB1 receptor antagonists include, but are not limited to, namacizumab, GRC-10801, MRI-1569, MRI-1867, DBPR-211, AM-6527: AM-6545,
    Petition 870190105365, of 10/18/2019, p. 37/148
    10/182
    NESS-11-SM, CXB-029, GCC-2680, TM-38837, Org-50189, PF514273, BMS-812204, ZYO-1, AZD-2207, AZD-1175, otenabant, ibipinabant, surinabant, surimonabant, rimonabant, drinabant, SLV-326, V24343 and 0-2093.
    [0034] Illustrative cannabinoid CB2 receptor mimetics include, but are not limited to, anabasum (Resunab, JKT-101).
    [0035] Illustrative caspase inhibitors include, but are not limited to, emricasan, belnacasan, nivocasan, IDN7314, F-573, VX-166, YJP-60107, MX-1122, IDN-6734, TLC-144, SB-234470, IDN-1965, VX-799, SDZ-220-976 and L-709049.
    [0036] Illustrative cathepsin inhibitors include, but are not limited to, VBY-376, VBY-825, VBY-036, VBY-129, VBY-285, Orb-219517, LY3000328, RG-7236 and BF / PC-18.
    [0037] Illustrative CCR antagonists include, but are not limited to, CCR2 / 5 antagonists, such as cenicriviroc; PG-092, RAP-310, INCB-10820, RAP-103, PF04634817 and CCX-872.
    [0038] Illustrative CD40 inhibitors include, but are not limited to, FFp-104, xl-050, DGM-0800, XmAb-5485, KGYY15, FFP-106, TDI-0028 and ABI-793.
    [0039] Illustrative CD80 inhibitors include, but are not limited to, RhuDex, FPT-155, ToleriMab, galiximab, SCH212394, IGM-001, ASP-2408 and SCH-204698.
    [0040] Illustrative CCR3 chemokine modulators and eotaxin 2 ligand inhibitors include, but are not limited to, bertilimumab, CM-101 (humanized), CM-102 and RNS60.
    [0041] Illustrative diacylglycerol-O-acyltransferase inhibitors include, but are not limited to, IONIS-DGAT2RX
    Petition 870190105365, of 10/18/2019, p. 38/148
    19/102 (formerly called ISIS-DGAT2Rx), LY-3202328, BH-03004, KR-69530, OT-13540, AZD-7687, PF-06865571, PF-06424439 and ABT-046.
    [0042] Illustrative dipeptidyl peptidase IV inhibitors include, but are not limited to, evogliptin, vidagliptin, photagliptin, alogliptin, saxagliptin, tilogliptin, anagliptin, sitagliptin, retagliptin, melogliptin, gosogliptin, trelagliptin, teneligliptine, linigliptine, lineliptliptine, linigliptina, lineligliptina, teneligliptina, teneligliptina, teneligliptina, teneligliptina, lineligliptina, teneligliptina, teneligliptina, teneligliptina, teneligliptina. betagliptin, imigliptin, omarigliptin, vidagliptin and denagliptin.
    Illustrative Fatty Acid Synthase (FAS) inhibitors include, but are not limited to, TVB-2640; TVB3664; TVB-3166, TVB-3150, TVB-3199, TVB-3693BZL-101, 2-octadecinoic acid, MDX-2, Fasnall, MT-061, G28UCM, MG-28, HS160, GSK-2194069, KD-023, cilostazol .
    [0044] In a particular embodiment, the FAS inhibitor is a compound selected from the following list of compounds:
    Petition 870190105365, of 10/18/2019, p. 39/148
    10/202

    Petition 870190105365, of 10/18/2019, p. 40/148
    10/212
    Petition 870190105365, of 10/18/2019, p. 41/148
    10/22

    [0045] In another particular modality, the inhibitor of
    FAS is selected from:
    and TVB-2640.
    [0046]
    In a particular embodiment, the FAS inhibitor is
    TVB-2640.
    Petition 870190105365, of 10/18/2019, p. 42/148
    10/23
    [0047] TGR5 agonists / Farnesoid X Double receptor (FXR) include, but are not limited to, INT-767.
    [0048] Illustrative NOX (NADPH oxidase) inhibitors include, but are not limited to, double 1 & 4 NOX inhibitors; GKT-831 (2- (2-chlorophenyl) -4- [3- (dimethylamino) phenyl] -5methyl-1H-pyrazol [4,3-c] pyridine-3,6 (2H, 5H) -dione), previously GKT137831 and GKT-901.
    [0049] Illustrative extracellular matrix protein modulators include, but are not limited to, CNX-024, CNX025 and SB-030.
    [0050] Illustrative farnesoid X (FXR) receptor agonists include, but are not limited to, obeticolic acid (OCA), GS-9674, LJN-452 or LJN452, LMB763, EDP305, AKN-083, INT-767, GNF-5120 , LY2562175, INV-33, NTX023-1, EP-024297, Px-103 and SR-45023.
    [0051] Illustrative fractalquin ligand inhibitors include, but are not limited to, E-6011 and KAN0440567.
    [0052] The Growth Factor receptor ligand
    Illustrative Fibroblast 19 (FGF-19), Illustrative Recombinant Fibroblast Growth Factor 19 (FGF-19) protein or illustrative functional manipulated variant of FGF-19 include, but are not limited to, NGM-282.
    [0053] The Growth Factor receptor ligand
    Illustrative Fibroblast 21 (FGF-21), Illustrative Fibroblast Growth Factor 21 (FGF-21) protein includes, but is not limited to, PEG-FGF21 (formerly BMS-986036), YH-25348, BMS-986171, YH-25723 , LY-3025876 and NNC-0194-0499.
    [0054] Illustrative galectin 3 inhibitors include, but are not limited to, GR-MD-02, TD-139, ANG-4021,
    Petition 870190105365, of 10/18/2019, p. 43/148
    10/242
    Galectin-3C, LJPC-201, TFD-100, GR-MD-03, GR-MD-04, GM-MD01, GM-CT-01, GM-CT-02, Gal-100 and Gal-200.
    Illustrative glucagon-like peptide 1 (GLP-1) analogs include, but are not limited to, semagglutide, liraglutide, exenatide, albiglutide, dulaglutide, lixisenatide, loxenatide efpeglenatide, taspoglutide, MKC-253, DLP-205 and DLP-205 0901.
    The illustrative glucagon-like peptide receptor agonist (GLP-1) illustrative includes, but is not limited to, LY-3305677 and long-acting oxintomodulin.
    [0057] Illustrative G protein-coupled receptor modulators include, but are not limited to, CNX-023.
    [0058] The illustrative G protein-coupled 84 receptor antagonist (GPR84 antagonist), connective tissue growth factor ligand inhibitor and free fatty acid receptor 1 agonist (FFAR1 agonist) include, but are not limited to, PBI -4050, PBI-4265, PBI-4283
    and PBI-4299. [0059] The inhibitors trajectory in signaling Hedgehog's cell include, however without limitation, Vismodegib, TAK-44 1, IPI-926,Saridegib, Sonidegib / Erismodegib, BMS-833923 / XL139, FEDERAL POLICE- 04449913, Taladegib / 1Y2940680, ETS- -2400, SHR-1539 and CUR61414.
    [0060] Inhibitors of ileum bile acid cotransporter include, but are not limited to, A-4250, GSK2330672, volixibat, CJ-14199 and elobixibat.
    [0061] Illustrative immunomodulators include, but are not limited to, PBI-4050, PBI-4265, PBI-4283, PBI-4299 and AIC-649.
    [0062] The illustrative insulin sensitizer and
    Petition 870190105365, of 10/18/2019, p. 44/148
    Illustrative 25/102 MCH receptor 1 antagonists include, but are not limited to, MSDC-0602k, MSDC-0602, CSTI-100 and AMRI.
    [0063] Illustrative integrin inhibitors include, but are not limited to, Pliant Therapeutic integrin inhibitors, Indalo Therapeutics integrin inhibitors, St Louis University integrin inhibitors, ProAgio and GSK-3008348.
    [0064] Illustrative ketohexokinase inhibitors include, but are not limited to, JNJ-28165722; JNJ-42065426; JNJ-42152981; JNJ-42740815; JNJ-42740828 and PF-06835919.
    [0065] Illustrative leukotriene / phosphodiesterase / lipoxygenase inhibitors include, but are not limited to, tipelukast (formerly MN001), tomelukast, sulukast, masilukast, zafirlukast, pranlukast, montelukast, gemilukast, verlukast, aklukast, aklastast, pastikastikast.
    [0066] Inhibitors homologous to lysyl oxidase 2 include, but are not limited to, Rappaport, InterMune, Pharmaxis, AB-0023, Simtuzumab, PXS-5382A and PXS-5338.
    [0067] Illustrative macrolides include, but are not limited to, solithromycin, azithromycin and erythromycin.
    [0068] Illustrative macrophage mannose receptor modulators include, but are not limited to, AB-0023, MT1001, [18F] FB18mHSA, Xemys, technetium Tc 99m tilmanocept and CDX-1307.
    [0069] The methyl-CpG-binding protein 2 modulator and illustrative transglutaminase inhibitors include, but are not limited to, cysteamine, EC Cysteamine, enteric coated cysteamine bitartrate, enteric coated cysteamine bitartrate, Bennu, bitartrate
    Petition 870190105365, of 10/18/2019, p. 45/148
    26/102 cysteamine (enteric coated), Raptor, cysteamine bitartrate, DR Cysteamine, delayed-release enteric coated cysteamine, mercaptamine, mercaptamine (enteric coated), Bennu, mercaptaminA (enteric coated), Raptor, RP-103, RP-104, PROCYSBI and mercaptamine (with enteric coating).
    [0070] Illustrative miRNA antagonists include, but are not limited to, RG-125 (formerly AZD4076), RGLS5040, RG-101, MGN-5804 and MRG-201.
    [0071] Illustrative metalloprotease-9 (MMP-9) enhancers include, but are not limited to, MMP-9 enhancer from Elastomics Ab.
    Illustrative mitochondrial carrier family inhibitor and mitochondrial phosphate carrier protein inhibitor include, but are not limited to, TRO-19622, Trophos, olesoxime, RG-6083 or RG-7090919.
    [0073] Illustrative myeloperoxidase inhibitors include, but are not limited to, PF-06667272.
    Illustrative monoclonal antibodies (rnAbs) include, but are not limited to, bertilimumab, NGM-313, IL-20 bleaching rnAbs, fresolimumab (antiTGFp) (formerly GC1008), timolumab formerly BTT-1023, namacizumab, omalizumab, ranibiziz , bevacizumab, lebrikizumab, epratuzumab, felvizumab, matuzumab, monalizumab, reslizumab, foralumab (NI-0401, anti-CD3), simtizumab (GS-6624) mAb against LOXL2, ustekinumab, an anti-TNF antibody and inebil.
    [0075] Illustrative monoclonal antibodies are selected from the group consisting of anti-lL20 rnAbs,
    Petition 870190105365, of 10/18/2019, p. 46/148
    27/102 anti-TGFp antibodies, anti-CD3 antibodies, antiLOXL2 antibodies and anti-TNF antibodies.
    [0076] Illustrative mTOR modulators include, but are not limited to, gene therapy of MSDC-0602 and AAV co-administered with SVP-sirolimus.
    [0077] NAD-dependent deacetylase sirtuin stimulator; PDE inhibitor 5 include, but are not limited to, NS0200.
    [0078] Illustrative NF-kappa B inhibitors include, but are not limited to, LC-280126.
    Illustrative Nicotinic Acid Receptor (GPR109) agonists include, but are not limited to, ARI3037MO, MMF, LUF 6283, Acifran, IBC 293, MK-1903, GSK256073, MK-6892, MK-0354, SLx-4090, lomitapide, lexibulin, apabetalone, acifran, laropiprant, daporinad, anacetrapib, INCB-19602, ST-07-02, lomefloxacin, Niacin and controlled / laropiprant release.
    [0080] Illustrative non-steroidal anti-inflammatory drugs (NSAIDs) include, but are not limited to, F-351,
    salicylates (aspirin), acetaminophen, derivatives in acid propionic (ibuprofen, naproxen), derivatives in acid acetic (indomethacin, diclofenac), derivatives in acid enolic (pi roxicam, phenylbutazone), derivatives in acid anthranilic (meclofenálmico acid, flufenamic acid),
    selective COX-2 inhibitors (celecoxib, parecoxib) and sulfonanilides (nimesulide).
    [0081] Illustrative nuclear receptor ligands include, but are not limited to, DUR-928 (formerly DV 928).
    [0082] Illustrative P2Y13 protein agonists
    Petition 870190105365, of 10/18/2019, p. 47/148
    28/102 include, but are not limited to, CER-209. [0083] Illustrative PDGFR modulators include, but are not limited to, BOT-501 and BOT-191. [0084] Illustrative phenylalanine hydroxylase enhancers include, but are not limited to, Pegvaliase, sapropterin, AAV-PAH, CDX-6114, sepiapterine, NMR-168, ALTU-236, ETX-101, HepaStem, rolipram and alprostadil. [0085] Illustrative PPAR-alpha agonists include, but are not limited to, fenofibrate, ciprofibrate, pemafibrate, gemfibrozil, clofibrate, binifibrate, clinofibrate, clofibric acid, nicofibrate, pyrifibrate, plafibride, ronifibrate, teofibrate, 17 and tocofibrate; [0086] Illustrative PPAR-gamma agonists include, but are not limited to, Pioglitazone, Deuteratod Pioglitazone, Rosiglitazone and Efatutazone, ATx08-001, WHO-405, CHS-131,
    THR-0921, SER-150-DN, KDT-501, GED-0507-34-Levo, CLC-3001 and ALL-4. [0087] PPAR-delta agonists include, but are not limited to, GW501516 (Endurabol or ({4 - [({4-methyl-2 [4- (trifluoromethyl) phenyl] -1,3-thiazol-5-yl } methyl) sulfanyl] 2-methylphenoxy} acetic)), MBX8025 (Seladelpar or {2methyl-4- [5-methyl-2- (4-trifluoromethyl-phenyl) -2H [1,2,3] triazole-4- ilmetilsilfanil] -phenoxy} -acetic), GW0742 or acid ([4 - [[[2- [3-fluoro-4- (trifluoromethyl) phenyl] -4methyl-5-thiazolyl] methyl] thio] -2-methylphenoxy] acetic ), L165041, HPP-593 or NCP-1046.
    [0088] Illustrative PPAR-alpha / gamma agonists (also called glitazars) include, but are not limited to, Saroglitazar, Aleglitazar, Muraglitazar, Tesaglitazar and DSP-8658.
    Petition 870190105365, of 10/18/2019, p. 48/148
    10/29
    [0089] In addition to elafibranor, illustrative PPARalpha / delta agonists include, without limitation, T913659.
    [0090] The illustrative PPAR-gamma / delta agonist includes, but is not limited to, a conjugated linoleic acid (CLA) and T3D-959.
    [0091] Illustrative PPAR-alpha / gamma / delta agonists or illustrative pan-PPAR agonists include, but are not limited to, IVA337 (Lanifibranor), TTA (tetradecylthioacetic acid), Bavachinin, GW4148, GW9135, Bezafibrata, Lobeglitazona and CS0 .
    Illustrative protease-activated receptor (PAR) -2 antagonists include, but are not limited to, PZ-235 and NP-003.
    [0093] Illustrative protein kinase modulators include, but are not limited to, CNX-014, MB-11055, ALF-1, mangiferin, amlexanox, GS-444217, REG-101 and valine.
    Illustrative Rho-associated protein kinase 2 inhibitors (ROCK2) include, but are not limited to, KD025, TRX-101, BA-1049, LYC-53976, INS-117548 and RKI-1447.
    [0095] Illustrative signal regulation kinase 1 (ASK1) inhibitors include, but are not limited to, selonsertib (formerly GS-4997).
    [0096] Illustrative sodium-glucose 1 (SGLT) inhibitors include, but are not limited to, LX4212 / lX-4211 / sotagliflozin, SAR -439954, LIK-066 (Licoglifozin), LX-2761, GSK-161235, LP -925219, KGA-2727, SAR-7226, SAR-474832, SY-008 and AVX-3030.
    [0097] Illustrative sodium-glucose transport inhibitors (SGLT) include, but are not limited to, remogliflozin, dapagliflozin, empagliflozin,
    Petition 870190105365, of 10/18/2019, p. 49/148
    30/102 ertugliflozin, sotagliflozin, ipragliflozin, thianagliflozin, canagliflozin, tofogliflozin, janagliflozin, bexagliflozin, luseogliflozin, sergliflozin, HEC-44616, AST-1935 and PLD. Illustrative stearoyl CoA desaturase1 / fatty acid bile acid conjugates include, but are not limited to, aramchol, GRC-9332, steamchol, TSN-2998, GSK-1940029 and XEN-801.
    [0099] Illustrative thyroid hormone (THR β) receptor agonists include, but are not limited to, VK-2809, MGL-3196, MGL-3745, SKL-14763, sobothyroid, BCT-304, ZYT-1, MB -07811 and eprotiroma.
    [0100] Illustrative Toll-like Receptor 2 and 4 (TLR-2) antagonists include, but are not limited to, 01201 also known as VB-201.
    [0101] Illustrative Toll-like Receptor 4 (TLR-4) antagonists include, but are not limited to, naltrexone, JKB-121 also known as Nalmefene, M62812, resatorvid, dendrophylline, CS-4771, AyuV-1, AyuV-25 , NI-0101, EDA-HPVE7 and eritoran.
    [0102] Illustrative type I natural killer T cell inhibitors include, but are not limited to, GRI-0621.
    [0103] Illustrative tyrosine kinase receptor (RTK) modulators include, but are not limited to, CNX-025, KBP-7018 nintedanib and sorafenib.
    [0104] Illustrative urate 1 anion exchanger inhibitors and xanthine oxidase inhibitors include, but are not limited to, lesinurad, RLBN-1001, verinurad, KUX-1151 and lesinurad + allopurinol.
    Petition 870190105365, of 10/18/2019, p. 50/148
    10/312
    [0105] Inhibitors of vascular adhesion protein-1 (VAP-1) also called Copper Amine Oxidase containing 2 (AOC3), include, but are not limited to BI-1467335 formerly PXS-4728A, CP-664511, PRX-167700, ASP-8232, RTU-1096, RTU-007 and BTT-1023.
    [0106] Illustrative vitamin D receptor (VDR) agonists include, but are not limited to, calciferol, alfacalcidol, 1,25-dihydroxyvitamin D3, Vitamin D2, Vitamin D3, calcitriol, Vitamin D4, Vitamin D5, dihydrotacisterol, calcipotriol , tacalcitol 1,24-dihydroxyvitamin D3 and paricalcitol.
    [0107] According to the present invention, the term PPAR (s) agonists refers to Peroxisome Proliferating Activated Receptor agonists, which are a class of drugs that play a central role in lipid and glucose homeostasis. PPARa mainly influences fatty acid metabolism and its activation decreases lipid levels, while PPARy is mostly involved in the regulation of adipogenesis, energy balance and lipid biosynthesis. PPARõ participates in fatty acid oxidation, for the most part, in heart and skeletal muscles, but it also regulates cholesterol and blood glucose levels.
    [0108] In a more particular embodiment, the compound of formula (I) is Elafibranor or a pharmaceutically acceptable salt thereof.
    [0109] In a particular embodiment of the combination product of the invention:
    component (i) is Elafibranor or a pharmaceutically acceptable salt thereof; and
    Petition 870190105365, of 10/18/2019, p. 51/148
    32/102 component (ii) is selected from GKT-831, aramchol, SHP-625, emricasan, saroglitazar, IMM-124-E, GS9674, NGM-282, A-4250, GR-MD-02, GS- 4997, F-351, solithromycin, remogliflozin, BTT-1023, IVA-337 (Lanifibranor), JKB-121 (Nalmefeno), KD-025, MSDC-0602 or MSDC-0602k, PBI-4050, PEG-FGF21, tipelukast, VK-2809, MGL3196, GS-0976, RG-125, volixibat, pioglitazone, semagglutide, GSK2330672, MBX-8025, CP-640186, Selonsertib, GKT-831, PXS-4728A, Vismodegib, CF-102 (Namodenoson), MT3995 (Apararenone), icosapentethyl ester, KD-025, DUR-928 and Gemcabene, in particular Selonsertib, GKT-831, PXS-4728A, Aramchol, PBI-4050, MSDC-0602k, VK-2809, MGL-3196, Vismodegib, CF -102 (Namodenoson), MT-3995 (Apararenone), JKB-121 (Nalmefeno), emricasan, KD-025 and DUR-928.
    [0110] In a modality particular of product of combination of the invention:component (i) is Elafibranor or a salt pharmaceuticallycomponent ( acceptable of the same; andii) is selected from of GKT-831,
    aramchol, SHP-625, emricasan, saroglitazar, IMM-124-E, GS9674, NGM-282, A-4250, GR-MD-02, GS-4997, LJN-452, F- 351, solithromycin, remogliflozina, BTT- 1023, IVA-337 (Lanifibranor), JKB-121, KD-025, MSDC-0602, PBI-4050, PEGFGF21, tipelukast, VK-2809, MGL-3196, GS-0976, pentasa, RG125, volixibat, pioglitazone, acid ursodeoxycholic, semagglutide, GSK2330672, and MBX-8025, in particular, from aramchol, SHP-625, emricasan, saroglitazar, IMM124-E, GS-9674, NGM-282, A-4250, GR-MD-02, GS -4997, LJN452, F-351, solithromycin, remogliflozin, BTT-1023, IVA337 (Lanifibranor), JKB-121, KD-025, MSDC-0602, PBI-4050,
    Petition 870190105365, of 10/18/2019, p. 52/148
    10/332
    PEG-FGF21, tipelukast, VK-2809, MGL-3196, GS-0976, RG-125, volixibat, pioglitazone, ursodeoxycholic acid, semagglutide, GSK2330672 and MBX-8025. [0111] In a particular embodiment of the combination product of the invention:
    component (i) is Elafibranor or a pharmaceutically acceptable salt thereof; and component (ii) is selected from GKT-831, aramchol, SHP-625, emricasan, saroglitazar, IMM-124-E, GS9674, NGM-282, A-4250, GR-MD-02, GS-4997, F-351, solithromycin, remogliflozin, BTT-1023, IVA-337 (Lanifibranor), JKB-121, KD-025, MSDC-0602, PBI-4050, PEGFGF21, tipelukast, VK-2809, MGL-3196, GS-0976 , pentasa, RG125, volixibat, pioglitazone, semagglutidA, GSK2330672 and MBX-8025
    [0112] In a particular embodiment, the combination product is a combination of ELA and GKT-831, ELA and Selonsertib, ELA and GS-0976 or ELA and Pentasa.
    [0113] In a particular embodiment, the combination product is a combination of ALS and GS-097 6, ALS and CP640186, ALS and Selonsertib, ALS and GKT-831 (formerly GKT137831), ALS and BI-1467335 / PXS-4728A , SHE and Aramchol, SHE and PBI-4050, SHE and MSDC-0602k, SHE and VK-2809, SHE and MGL3196, SHE and Vismodegib, SHE and CF-102 (Namodenoson), SHE and MT-3995 (Apararenone), SHE and JKB-121 (Nalmefene), ALS and Emricasan, ALS and KD-025, ALS and DUR-928 or ALS and Gemcabeno. [0114] In a particular embodiment, the combination product is a combination of ELA and Selonsertib, ELA and GKT-831 (formerly GKT137831), ELA and BI-1467335 / PXS4728A, ELA and Aramchol, ELA and PBI-4050, ELA and MSDC-0602k,
    Petition 870190105365, of 10/18/2019, p. 53/148
    10/34
    SHE and VK-2809, SHE and MGL-3196, SHE and Vismodegib, SHE and CF102 (Namodenoson), SHE and MT-3995 (Apararenone), SHE and JKB121 (Nalmefeno), SHE and Emricasan, SHE and KD-025, and ELA and DUR-928.
    [0115] In an additional particular variant of this modality, component (ii) is not an OCA or CVC.
    [0116] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is selected from an ACC inhibitor, an ASK1 inhibitor, a NOXI and a double NOX4, a VAP-1 inhibitor, stearoyl CoA desaturase1 inhibitors / a fatty acid bile acid conjugate, a GPR84 antagonist / FFAR1 immunomodulator or agonist, a mTOR modulator or insulin sensitizer, a THRp agonist, a THRp inhibitor Hedgehog signaling pathway, an A3 adenosine receptor agonist, an aldosterone receptor antagonist, a TLR-4 antagonist, a caspase inhibitor, a ROCK2 inhibitor and a nuclear receptor ligand.
    [0117] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is an ACC inhibitor (in particular, GS-0976 or CP-640186 or Gemcabeno), a inhibitor of ASK1 (in particular, Selonsertib), an inhibitor of NOXI and double NOX4 (in particular, GKT-831, formerly GKT137831), an inhibitor of VAP-1 (in particular, B1-1467335 / PXS-4728A), inhibitors of stearoyl CoA desaturase-1 / fatty acid bile acid conjugate (in particular, Aramchol), a GPR84 antagonist / FFAR1 agonist or immunomodulator (in particular, PBI-4050), a mTOR modulator or
    Petition 870190105365, of 10/18/2019, p. 54/148
    35/102 insulin sensitizer (in particular, MSDC-0602k), a THRb agonist (in particular, VK-2809 or MGL-3196), a hedegehog signaling pathway inhibitor (in particular, Vismodegib), a receptor agonist adenosine A3 (in particular, CF-102 (Namodenoson)), an aldosterone receptor antagonist (in particular, MT3995 (Apararenone)), a TLR-4 antagonist (in particular, JKB-121 (Nalmefene)), a caspase inhibitor (in particular, emricasan), a ROCK2 inhibitor (in particular, KD-025), and a nuclear receptor ligand (in particular, DUR-928).
    [0118] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is an ASK1 inhibitor, a NOXI and a double NOX4, a VAP-1 inhibitor, stearoyl inhibitors CoA desaturase-1 / a fatty acid bile acid conjugate, a GPR84 antagonist / immunomodulator or FFAR1 agonist, an mTOR modulator or insulin sensitizer, a THRp agonist, a Hedgehog signaling pathway inhibitor, a Hedgehog signaling pathway agonist adenosine A3 receptor, an aldosterone receptor antagonist, a TLR-4 antagonist, a caspase inhibitor, a ROCK2 inhibitor and a nuclear receptor ligand.
    [0119] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof, and component (ii) is an ASK1 inhibitor (in particular, Selonsertib), a double NOXI and NOX4 inhibitor (in particular, GKT-831, formerly GKT137831), a VAP-1 inhibitor (in particular, B1-1467335 / PXS-4728A), stearoyl CoA desaturase-1 / bile acid conjugate inhibitors
    Petition 870190105365, of 10/18/2019, p. 55/148
    36/102 fatty acid (in particular, Aramchol), a GPR84 antagonist / FFAR1 agonist or immunomodulator (in particular, PBI-4050), a mTOR modulator or insulin sensitizer (in particular, MSDC-0602k), an agonist THRb (in particular, VK-2809 or MGL-3196), a hedegehog signaling pathway inhibitor (in particular Vismodegib), an A3 adenosine receptor agonist (in particular, CF-102 (Namodenoson)), an antagonist aldosterone receptor (in particular MT-3995 (Apararenone)), a TLR-4 antagonist (in particular, JKB-121 (Nalmefene)), a caspase inhibitor (in particular, emricasan), a ROCK2 inhibitor ( in particular, KD-025), and a nuclear receptor ligand (in particular, DUR-928). [0120] In a particular embodiment, component (1) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is an ACC inhibitor. [0121] In a more particular embodiment, component (1) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is GS-0976, CP-640186 or
    Gemcabeno. [0122] In a more particular embodiment, component (1) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is GS-0976. [0123] In a more particular embodiment, component (1) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is CP-640186. [0124] In a more particular embodiment, component (1) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is Gemcabene.
    Petition 870190105365, of 10/18/2019, p. 56/148
    37/102
    [0125] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is an ASK1 inhibitor.
    [0126] In a more particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is Selonsertib.
    [0127] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is a double NOX1 or NOX4 inhibitor.
    [0128] In a more particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is GKT-831.
    [0129] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is a VAP-1 inhibitor.
    [0130] In a more particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is BI-1467335 / PXS-4728A.
    [0131] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is a stearoyl CoA desaturase-1 / bile acid conjugate of fatty acid.
    [0132] In a more particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is Aramchol.
    [0133] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is a GPR84 antagonist / FFAR1 agonist.
    [0134] In a more particular modality, the component
    Petition 870190105365, of 10/18/2019, p. 57/148
    38/102 (1) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is PBI-4050.
    [0135] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is an mTOR modulator or insulin sensitizer.
    [0136] In a more particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is, in particular, MSDC-0602k.
    [0137] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is a THRp agonist.
    [0138] In a more particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is VK-2809 or MGL-3196.
    [0139] In a more particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is VK-2809.
    [0140] In a more particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is MGL-3196.
    [0141] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is an inhibitor of the cell Hedgehog signaling pathway.
    [0142] In a more particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is Vismodegib.
    [0143] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof
    Petition 870190105365, of 10/18/2019, p. 58/148
    39/102 and component (ii) is an A3 Adenosine receptor agonist.
    [0144] In a more particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is CF-102 (Namodenoson).
    [0145] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is an aldosterone receptor antagonist.
    [0146] In a more particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is MT-3995 (Apararenone).
    [0147] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is a TLR-4 antagonist.
    [0148] In a more particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is JKB-121 (Nalmefene).
    [0149] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is a nuclear receptor ligand.
    [0150] In a more particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is Emricasan.
    [0151] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is a ROCK2 inhibitor.
    [0152] In a more particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is KD-025.
    Petition 870190105365, of 10/18/2019, p. 59/148
    40/102
    [0153] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is a nuclear receptor ligand.
    [0154] In a particular embodiment, component (i) is Elafibranor or a pharmaceutically acceptable salt thereof and component (ii) is DUR-928.
    [0155] In a particular embodiment, the combination product of the invention additionally comprises at least one other therapeutically active agent selected from JAK / STAT inhibitors and another anti-inflammatory agent and / or an immunosuppressive agent.
    [0156] Illustrative anti-inflammatory and / or immunosuppressive agents comprise glucocorticoids, NSAIDS, cyclophosphamide, nitrosoureas, folic acid analogs, purine analogs, pyrimidine analogs, methotrexate, azathioprine, mercaptopurine, cyclosporine, miriocin, tyrolimol, tyrolimol, tyrolimol, tyrolimol, tyrolimine, tyrolimol, tyrolimol, mycophenolic acid, fingolimod and other modulators of sphingosine-1-phosphate receptor, monoclonal and / or polyclonal antibodies against such targets as pro-inflammatory cytokines and pro-inflammatory cytokine receptors, T cell receptor and integrins.
    [0157] In another particular embodiment, the combination of the invention may further comprise at least one therapeutically active agent with antifibrotic activity, such as tyrosine kinase or pirfenidone receptor inhibitors (RTKIs) such as Nintedanib, Sorafenib and other RTKIs or receptor blockers angiotensin II (ATI) or CTGF inhibitor or any antifibrotic compound susceptible to interference with trajectories activated by
    Petition 870190105365, of 10/18/2019, p. 60/148
    41/102
    TGFp and BMP including activators of the latent TGFp complex such as MMP2, MMP9, THBS1 or cell surface integrins, TGFp receptors type I (TGFBRI) or type II (TGFBRII) and their ligands, such as TGFp, Activin, inhibin, Nodal, hormone anti-Müllerian, GDFs or BMPs, auxiliary co-receptors (also known as type III receptors) or components of the canonical pathways dependent on SMAD including members or proteins of SMAD that are regulatory or inhibitory to non-canonical or independent pathways of SMAD including various signaling branches MAPK, TAK1, Rho-like GTPase signaling trajectories, phosphatidylinositol-3 kinase / AKT trajectories, TGFp-induced EMT process or canonical and non-canonical Hedgehog signaling trajectories including Hh ligands or target genes or any members of the WNT or Notch trajectories that are likely to influence TGFp signaling.
    [0158] In a specific embodiment of the invention, the other therapeutically active agent is a PPAR agonist.
    [0159] In another particular embodiment, the PPAR agonist is a PPAR-alpha agonist, a PPAR-gamma agonist, a PPAR-delta agonist, a double PPAR-alpha / gamma agonist, a PPAR- alpha / double delta, a PPAR-gamma / double delta agonist or a panPPARalpha / gamma / delta agonist.
    [0160] In a particular embodiment, the other therapeutically active agent is:
    - at least one PPAR-alpha agonist;
    - at least one PPAR-gamma agonist;
    - at least one PPAR-delta agonist;
    Petition 870190105365, of 10/18/2019, p. 61/148
    42/102
    - at least one double PPAR-alpha / delta agonist;
    - at least one PPAR-alpha agonist and at least one PPAR-delta agonist;
    - at least one double PPAR-alpha / gamma agonist;
    - at least one PPAR-alpha agonist and at least one PPAR-gamma agonist;
    - at least one PPAR-gamma / double delta agonist;
    - at least one PPAR-gamma agonist and at least one PPAR-delta agonist;
    - at least one PAN-PPAR-alpha / gamma / delta agonist; and
    - at least one PPAR-alpha agonist, at least one PPAR-gamma agonist and at least one PPARdelta agonist.
    [0161] In a particular embodiment, the combination product of the invention is a composition comprising components (i) and (ii) as described above, and a pharmaceutically acceptable carrier.
    [0162] In a particular embodiment, the combination product is a kit of parts comprising components (i) and (ii) as described above, for sequential, separate or simultaneous use.
    [0163] In an additional embodiment, components (i) and (ii) are formulated in a suspension for injection, a gel, an oil, a pill, a tablet, a suppository, a powder, a capsule, an aerosol, an ointment , a cream, a plaster or galenic forms means for a prolonged and / or slow release.
    [0164] The present invention also relates to the combination product according to the invention, for use as a medicament.
    Petition 870190105365, of 10/18/2019, p. 62/148
    43/102
    [0165] The invention also relates to the combination product disclosed herein, for use in a method for treating a disease. In another embodiment, the invention relates to a method for the treatment of a disease, which comprises administering to a subject in need thereof a therapeutically effective amount of the combination product disclosed herein. In another embodiment, the use of a combination product according to the invention is provided for the manufacture of a medicament for the treatment of a disease.
    [0166] In particular, the combination product of the present invention is useful for the treatment of diseases such as immune, inflammatory, metabolic, fibrotic and cholestatic diseases. In a particular embodiment, the disease is selected from the group consisting of metabolic liver disease, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), drug-induced liver disease, alcohol-induced liver disease, Infectious agent-induced liver disease, inflammatory liver disease, liver disease mediated by immune system dysfunction, dyslipidemia, cardiovascular disease, restenosis, syndrome X, metabolic syndrome, diabetes, obesity, hypertension, chronic cholangiopathies such as Primary Sclerosing Cholangitis (PSC), Cholangitis Primary Biliary (PBC), biliary atresia, type 3 progressive familial intrahepatic cholestasis (PFIC3), inflammatory bowel disease, Crohn's disease, ulcerative colitis, keloid, myocardial infarction, systemic scleroderma / sclerosis, inflammatory diseases,
    Petition 870190105365, of 10/18/2019, p. 63/148
    44/102 neurodegenerative diseases, cancers, liver cancer, hepatocellular carcinoma, gastrointestinal cancer, gastric cancer, meningioma associated with neurofibromatosis, pancreatic neuroendocrine tumors pancreatic exocrine tumors leukemia dermatofibrosarcoma mastocytosis, lung tumors, solid tumors, thyroid cancer, breast cancer a prostate cancer, fibrosis or liver cirrhosis of any origin, fibrosis or liver cirrhosis induced by metabolic disease, NAFLD-induced fibrosis or cirrhosis, NASH-induced fibrosis or cirrhosis, alcohol-induced fibrosis or liver cirrhosis, liver-induced fibrosis or cirrhosis drugs, fibrosis or liver cirrhosis induced by an infectious agent, fibrosis or liver cirrhosis induced by parasite infection, fibrosis or liver cirrhosis induced by bacterial infection, fibrosis or cirrhosis induced by viral infection, fibrosis or liver cirrhosis induced by HBV infection, fibrosis or induced liver cirrhosis a by HCV infection, fibrosis or liver cirrhosis induced by HIV infection, fibrosis or liver cirrhosis induced by double infection by HCV and HIV, fibrosis or cirrhosis induced by radiation or chemotherapy, biliary tract fibrosis, fibrosis or liver cirrhosis due to any chronic cholestatic disease, intestinal fibrosis of any etiology, fibrosis induced by Crohn's disease, fibrosis induced by ulcerative colitis, fibrosis of the intestine (eg small intestine), colon fibrosis, stomach fibrosis, skin fibrosis, fibrosis of the epidermis, fibrosis endoderm, cutaneous fibrosis due to scleroderma / systemic sclerosis, fibrosis
    Petition 870190105365, of 10/18/2019, p. 64/148
    45/102 pulmonary, fibrosis following chronic inflammatory diseases of the airways, such as COPD, asthma, emphysema, smoker's lung, tuberculosis, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), cardiac fibrosis, renal fibrosis, nephrogenic systemic fibrosis, muscle fibrosis , soft tissue fibrosis (for example, mediastinum or retroperitoneum) fibrosis, bone marrow fibrosis, joint fibrosis, tendon fibrosis, cartilage fibrosis, pancreas fibrosis, uterine fibrosis, nervous system fibrosis, testis fibrosis, fibrosis of the ovary, adrenal gland fibrosis, arterial fibrosis, venous fibrosis, ocular fibrosis, endomyocardial fibrosis, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis, progressive massive fibrosis (a complication of pneumoconiosis in people working with coal), proliferative fibrosis, neoplastic fibrosis, peri-implant fibrosis and asbestosis, arthrofibrosis, adhesive capsulitis. [0167] In a form of maximum preference, the disease is selected from the group consisting of metabolic liver diseases, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), drug-induced liver diseases, diseases alcohol-induced liver disease, infectious agent-induced liver disease, inflammatory liver disease, liver disease mediated by immune system dysfunction, dyslipidemia, cardiovascular disease, restenosis, syndrome X, metabolic syndrome, diabetes, obesity, hypertension, chronic cholangiopathies such as Primary Sclerosing Cholangitis (PSC), Primary Biliary Cholangitis (PBC), biliary atresia, type 3 progressive familial intrahepatic cholestasis (PFIC3), inflammatory bowel disease,
    Petition 870190105365, of 10/18/2019, p. 65/148
    46/102
    Crohn's, ulcerative oolitis, liver cancer, hepatocellular carcinoma, gastrointestinal cancer, gastric cancer, colorectal cancer, fibrosis or liver cirrhosis induced by metabolic disease, NAFLD-induced fibrosis or cirrhosis, NASH-induced fibrosis or liver cirrhosis, alcohol-induced fibrosis or cirrhosis , drug-induced fibrosis or liver cirrhosis, infectious agent-induced fibrosis or liver cirrhosis, parasite-induced fibrosis or liver cirrhosis, bacterial infection-induced liver fibrosis, fibrosis or viral infection-induced fibrosis or liver cirrhosis by HBV infection, fibrosis or liver cirrhosis induced by HCV infection, fibrosis or liver cirrhosis induced by HIV infection, fibrosis or liver cirrhosis induced by double HCV and HIV infection, fibrosis or cirrhosis induced by radiation or chemotherapy, tract fibrosis disease, fibrosis or liver cirrhosis due to any chronic cholestatic disease intestinal fibrosis of any etiology, fibrosis induced by Crohn's disease, fibrosis induced by ulcerative colitis, fibrosis of the intestine (eg small intestine), colon fibrosis, stomach fibrosis, pulmonary fibrosis, fibrosis consecutive to chronic inflammatory diseases of airways, such as COPD, asthma, emphysema, smoker's lung, tuberculosis, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF).
    [0168] In a further aspect, the invention relates to the combination of the invention for use in inhibiting proliferation and / or activation of fibroblasts responsible for the production of collagen fibers and / or responsible for the production of the extracellular matrix.
    Petition 870190105365, of 10/18/2019, p. 66/148
    47/102
    [0169] According to the present invention, the term autoimmune diseases is used to denote a condition that arises from an abnormal immune response in the body against substances and tissues normally present in the body. The disease can be restricted to certain organs (for example, in type I diabetes or autoimmune thyroiditis) or it involves a particular tissue in different places (for example, in Goodpasture's disease, affection of the basement membrane in the lung and kidney).
    [0170] The term inflammation is used to designate a condition that arises from a protective response involving host cells, blood vessels, and proteins and other mediators that can serve to eliminate the cause of cell / tissue damage, as well as necrotic cells / tissues resulting from the original insult and to initiate the repair process. The inflammatory reaction can be manifested by pain, heat, redness, swelling, dilation of blood vessels, increased blood flow and loss of function.
    [0171] According to the present invention, the terms fibrosis, fibrotic disease, fibrotic disorder and declines thereof denote a pathological condition of excessive deposition of fibrous connective tissue in an organ or tissue. More specifically, fibrosis is a pathological process, which includes the formation of a persistent fibrotic scar and overproduction of extracellular matrix, by the connective tissue, as a response to tissue damage. Physiologically, the deposition of connective tissue can obliterate the architecture and function of the underlying organ or tissue.
    Petition 870190105365, of 10/18/2019, p. 67/148
    48/102
    [0172] According to the present invention, fibrosis or fibrotic disorder can be associated with any organ or tissue fibrosis. Illustrative non-limiting examples of particular organ fibrosis include liver, digestive tract, kidney, skin, epidermis, endoderm, muscle, tendon, cartilage, heart, pancreas, lung, uterus, nervous system, testicles, penis, ovary, adrenal gland, artery, vein, colon, intestine (eg small intestine), biliary tract, soft tissue (eg mediastinum or retroperitoneum), bone marrow, joint or stomach fibrosis, in particular liver, kidney, skin, epidermis, endoderm, muscle, tendon, cartilage, heart, pancreas, lung, uterus, nervous system, testicles, ovary, adrenal gland, artery, vein, colon, intestine (eg small intestine), biliary tract, soft tissue (eg mediastinum or retroperitoneum), bone marrow, joint fibrosis, eye or stomach.
    [0173] According to the present invention, the terms cholestasis or cholestatic disease or cholestatic disorder and their declination denote a pathological condition defined by a decrease in the flow of bile due to impaired secretion by hepatocytes or obstruction of the flow of bile through extrahepatic or intrahepatic bile ducts. Therefore, the clinical definition of cholestasis is any condition in which substances normally excreted in bile are retained.
    [0174] In a particular embodiment, fibrotic disorder is selected from the group consisting of fibrosis of the liver, digestive tract, lung, heart, kidney, muscle, skin, soft tissue (for example, mediastinum or
    Petition 870190105365, of 10/18/2019, p. 68/148
    49/102 retroperitoneum), bone marrow, intestinal and joint (for example, knee, shoulder or other joints).
    [0175] In a preferred embodiment, the fibrotic disorder is selected from the group consisting of fibrosis of the liver, lung, skin, kidney and intestine.
    [0176] In a preferred embodiment of the present invention, the treated fibrotic disorder is selected from the group consisting of the following non-exhaustive list of fibrotic disorders: non-alcoholic steatohepatitis (NASH), pulmonary fibrosis, idiopathic pulmonary fibrosis, skin fibrosis, eye fibrosis (such as capsular fibrosis) endomyocardial fibrosis, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis, massive progressive fibrosis (a complication of coal workers' pneumoconiosis), proliferative fibrosis, neoplastic fibrosis, pulmonary fibrosis following chronic inflammatory diseases of the airways ( COPD, emphysema and asthma, smoker's lung, tuberculosis), alcohol or drug-induced pulmonary fibrosis, liver cirrhosis, infection-induced pulmonary fibrosis, radiation therapy or chemotherapy-induced fibrosis, nephrogenic systemic fibrosis, Crohn's disease, ulcerative colitis, keloid, old myocardial infarction, scleroderma / systemic sclerosis, arthrofibrosis, al some forms of adhesive capsulitis, chronic fibrosing cholangiopathies, such as Primary Sclerosing Cholangitis (PSC) and Primary Biliary Cholangitis (PBC), biliary atresia, progressive family intrahepatic cholestasis type 3 (PFIC3), fibrosis and peri-implantation asbestosis.
    [0177] Cholestasis is defined as a decrease in the flow of bile due to impaired secretion by hepatocytes
    Petition 870190105365, of 10/18/2019, p. 69/148
    50/102 (hepatocellular cholestasis) or bile flow obstruction through intra- or extrahepatic bile ducts (obstructive cholestasis). In clinical practice, cholestasis is any condition in which the flow of bile from the liver is slowed or blocked. According to a particular embodiment of the invention, cholestestatic disease is selected from the group consisting of primary biliary cholangitis (PBC), primary sclerosing cholangitis (PSC), Intrahepatic Cholestasis of Pregnancy, Progressive Family Intrahepatic Cholestasis, Atresia biliary disease, cholelithiasis, infectious cholangitis, cholangitis associated with Langerhans cell histiocytosis, Alagille syndrome, non-syndromic ductal insufficiency, drug-induced cholestasis and cholestasis associated with total parenteral nutrition. In a preferred embodiment, the cholestatic disease is PBC or PSC, in particular, PBC.
    [0178] Examples of inflammatory diseases, fibrotic diseases, metabolic diseases and cholestatic diseases include metabolic liver diseases, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), drug-induced liver diseases, induced liver diseases by alcohol, infectious agent-induced liver disease, inflammatory liver disease, liver disease mediated by immune system dysfunction, dyslipidemia, cardiovascular disease, restenosis, syndrome X, metabolic syndrome, diabetes, obesity, hypertension, chronic cholangiopathies such as Primary Sclerosing Cholangitis (PSC ), Primary Biliary Cholangitis (PBC), biliary atresia, type 3 progressive familial intrahepatic cholestasis (PFIC3), intestinal diseases
    Petition 870190105365, of 10/18/2019, p. 70/148
    51/102 inflammatory diseases, Crohn's disease, ulcerative oolitis, keloid old myocardial infarction scleroderma / systemic sclerosis, inflammatory diseases, neurodegenerative diseases, cancers, liver cancer, hepatocellular carcinoma, gastrointestinal cancer, gastric cancer, meningioma associated with neurofibromatosis, tumors pancreatic exocrine tumors pancreatic disease leukemia mastocytosis dermatofibrosarcoma, solid tumors including breast, lung, thyroid or colorectal cancer, prostate cancer, pulmonary fibrosis or cirrhosis of any origin, cirrhosis or fibrosis induced by metabolic disease, cirrhosis or fibrosis induced by NAFLD , NASH-induced cirrhosis or fibrosis, alcohol-induced cirrhosis or pulmonary fibrosis, drug-induced cirrhosis or pulmonary fibrosis, infectious agent-induced pulmonary cirrhosis or fibrosis, infection-induced pulmonary cirrhosis or pulmonary fibrosis induced by infection bacterial, cirrhosis or fibrosis induced by viral infection, cirrhosis or pulmonary fibrosis induced by HBV infection, cirrhosis or pulmonary fibrosis induced by HIV infection, cirrhosis or pulmonary fibrosis induced by HIV infection, dual HCV and cirrhosis or pulmonary fibrosis induced by HIV infection , chemotherapy or radiation-induced cirrhosis or fibrosis, fibrosis of the biliary tract, pulmonary fibrosis or cirrhosis due to any chronic cholestetic disease, intestinal fibrosis of any etiology, Crohn's disease-induced fibrosis, ulcerative colitis-induced fibrosis, intestinal fibrosis (by
    Petition 870190105365, of 10/18/2019, p. 71/148
    52/102 example, small intestine), colon fibrosis, stomach fibrosis, skin fibrosis epidermis fibrosis endoderm fibrosis, skin fibrosis due to systemic scleroderma / sclerosis, pulmonary fibrosis, pulmonary fibrosis consecutive to chronic inflammatory diseases of the airways, such as COPD, emphysema and asthma, smoker's lung, tuberculosis, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), heart fibrosis, kidney fibrosis, nephrogenic systemic fibrosis, muscle fibrosis, soft tissue fibrosis (for example, mediastinum or retroperitoneum), bone marrow fibrosis, joint fibrosis, tendon fibrosis, cartilage fibrosis, fibrosis of the uterus, fibrosis of the uterus, fibrosis of the nervous system, fibrosis of the testes, ovarian fibrosis, fibrosis of the adrenal gland, artery fibrosis, vein fibrosis , fibrosis of the eye, endomyocardial fibrosis, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis, progressive massive fibrosis (a complication of pneumoconiosis in workers in the coal), proliferative fibrosis, neoplastic fibrosis, peri-implantation fibrosis and asbestosis, arthrofibrosis, adhesive capsulitis.
    [0179] Preferably, the disease is selected from the group consisting of metabolic liver disease, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), drug-induced liver disease, alcohol-induced liver disease, diseases liver diseases induced by an infectious agent, inflammatory liver diseases, liver diseases mediated by immune system dysfunction, dyslipidemia, cardiovascular diseases, restenosis, syndrome X, metabolic syndrome, diabetes, obesity, hypertension,
    Petition 870190105365, of 10/18/2019, p. 72/148
    53/102 chronic cholangiopathies such as Primary Sclerosing Cholangitis (PSC), Primary Biliary Cholangitis (PBC), biliary atresia, familial intrahepatic cholestasis type 3 (PFIC3), inflammatory bowel diseases, Crohn's disease, ulcerative colitis, liver cancer, carcinoma hepatocellular, gastrointestinal cancer, gastric cancer, colorectal cancer, pulmonary cirrhosis or fibrosis induced by metabolic disease, NAFLD-induced cirrhosis or fibrosis, NASH-induced cirrhosis or fibrosis, alcohol-induced cirrhosis or pulmonary fibrosis, drug-induced cirrhosis or pulmonary fibrosis, infectious agent-induced pulmonary cirrhosis or fibrosis, parasitic infection-induced pulmonary cirrhosis or pulmonary fibrosis, viral infection-induced cirrhosis or fibrosis, HBV infection-induced pulmonary cirrhosis or pulmonary fibrosis, cirrhosis or pulmonary fibrosis induced by HCV infection, cirrhosis or pulmonary fibrosis induced by HIV infection, dual HCV and cirrhosis or pulmonary fibrosis induced by HIV infection, cirrhosis or fibrosis induced by chemotherapy or radiation, fibrosis of the biliary tract, pulmonary fibrosis or cirrhosis due to any chronic cholestetic disease, intestinal fibrosis of any etiology, fibrosis induced by Crohn's disease, fibrosis induced by ulcerative colitis, intestinal fibrosis (eg small intestine), colon fibrosis, stomach fibrosis, pulmonary fibrosis, pulmonary fibrosis following chronic inflammatory airway diseases, such as COPD, emphysema and asthma, smoker's lung, tuberculosis, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF),
    [0180] The term treatment or treat refers to the
    Petition 870190105365, of 10/18/2019, p. 73/148
    54/102 curative or preventive treatment of a disorder in an individual in need of it. The treatment involves the administration of the compound comprised in particular in a pharmaceutical composition, to an individual who has a declared disorder, that is, to a patient, to cure, delay, reverse or slow down the progression of the disorder, thus improving the condition of the patient. individual. A treatment can also be given to an individual who is healthy or at risk of developing a cholestatic or fibrotic disorder to prevent or delay the disorder.
    [0181] Therefore, according to the invention, the treatment of an immune, inflammatory, metabolic, fibrotic and cholestatic disease involves the administration of the combination of the present invention, for example, in the form of a pharmaceutical composition containing components (i) and (ii) the combination, to an individual who has a disorder declared to cure, delay, reverse or slow the progression of the disorder, thereby improving the condition of the patient or a healthy individual, in particular, a person who is at risk of developing such a disease.
    [0182] The treatment involves administering the combination of the invention to a patient who has a declared disorder to cure, delay or slow down progress, thereby improving the condition of the patient or to a healthy individual, in particular, an individual who you are at risk of developing an inflammatory, metabolic, fibrotic and cholestatic disease.
    [0183] The individual to be treated is a mammal, preferably a human. The individual to be treated
    Petition 870190105365, of 10/18/2019, p. 74/148
    55/102 according to the invention can be selected based on several criteria associated with fibrotic diseases such as previous drug treatments, associated pathologies, genotype, exposure to risk factors, viral infection, as well as based on the detection of any relevant biomarker that it can be evaluated using imaging methods and methods of immunological, biochemical, enzymatic, chemical or nucleic acid detection.
    [0184] Individuals to be treated according to the invention can be selected based on several criteria associated with inflammatory, metabolic, fibrotic and cholestatic diseases such as previous drug treatments, associated pathologies, genotype, exposure to risk factors, viral infection , as well as based on the detection of any relevant biomarker that can be evaluated using imaging methods and methods of immunological, biochemical, enzymatic, chemical or nucleic acid detection.
    [0185] In a particular embodiment, the treatment of an inflammatory, metabolic, fibrotic and cholestatic disease may comprise the administration of a composition comprising at least two selected compounds of the formula (I). In this embodiment, the administered component (ii) is supplied in the same composition as the at least two compounds of the formula (I) or in a separate form, as in a different composition.
    [0186] In another embodiment, the combination of the invention is for simultaneous, sequential or separate administration in therapy, therefore, possibly being included in different compositions. In case of administration
    Petition 870190105365, of 10/18/2019, p. 75/148
    56/102 sequentially, the compound of formula (I), in particular, ALS, can be administered before component (ii) or component (ii) is (or are) administered before the compound of formula (I).
    [0187] A compound of formula (I) can be formulated as pharmaceutically acceptable salts, in particular, acid or base salts compatible with pharmaceutical use. The salts of the compounds of formula (I) include pharmaceutically acceptable acid addition salts, pharmaceutically acceptable base addition salts, pharmaceutically acceptable metal salts, ammonium salts and alkylated ammonium. These salts can be obtained during the final purification step of the compound or by incorporating the salt into the previously purified compound.
    [0188] The pharmaceutical compositions of the present invention may also comprise one or more excipients or vehicles, acceptable in a pharmaceutical context (for example, saline solutions, physiological solutions, isotonic solutions, etc., compatible with pharmaceutical use and well known to those with common skill in the technique).
    [0189] These compositions may also comprise one or more agents or vehicles chosen from dispersants, solubilizers, stabilizers, preservatives, etc. The agents or vehicles useful for these formulations (liquid and / or injectable and / or solid) are particularly methylcellulose, hydroxymethylcellulose, carboxymethylcellulose, polysorbate 80, mannitol, gelatin, lactose, vegetable oils, acacia, liposomes, etc.
    [0190] These compositions can be formulated in the form of suspensions, gels, oils, ointments, pills, tablets,
    Petition 870190105365, of 10/18/2019, p. 76/148
    57/102 suppositories, powders, gel caps, capsules, aerosols etc. eventually by means of devices or galenic forms ensuring a prolonged and / or slow release. For this type of formulation, agents such as cellulose, carbonates or starches can be advantageously used.
    [0191] The pharmaceutical compositions of the present invention that comprise a compound of formula (I) and one or more components (or components) (ii) can be administered in different ways and in different ways. For example, the compound (or compounds) can be administered via a systemic route, orally, parenterally, by inhalation, by nasal spray, by nasal instillation, or by injection, such as, for example, intravenously, intramuscularly, by subeutaneous, transdermally, topically, intraarterially, etc.
    [0192] Certainly, the route of administration will be adapted to the form of the compounds to be administered, according to procedures well known to the person skilled in the art.
    [0193] The components (i) and (ii) of the combination product of the invention are administered in a therapeutically effective amount. In the context of the invention, the term effective amount refers to an amount of the compound sufficient to produce the desired therapeutic result.
    [0194] The frequency and / or quantity relative to the administration can be adapted by a person of common skill in the technique, depending on the patient, the pathology, the form of administration, etc. Typically, the combination (as in the form of a pharmaceutical composition or a kit of parts) of the present invention can be
    Petition 870190105365, of 10/18/2019, p. 77/148
    58/102 administered for the treatment of a fibrotic disease in a dose for component (i) or component (ii) between 0.01 mg / day to 4000 mg / day, as from 50 mg / day to 2000 mg / day and particularly from 100 mg / day to 1000 mg / day.
    [0195] In a preferred embodiment of the invention, ALS is used in combination with component (ii) at a dose between 80 to 120 mg / day for Elafibranor.
    [0196] In another preferred embodiment, the active ingredients are administered as one or more pharmaceutical compositions in the form of a pill or tablet intended for oral ingestion.
    [0197] Administration can be carried out daily or even several times a day, if necessary.
    [0198] The invention is further described with reference to the following non-limiting examples.
    DESCRIPTION OF THE FIGURES
    Abbreviations used in figures, tables and text: Smooth Muscle α-SMA α-Actin
    AP-1 Activator Protein 1
    ASBTi
    ASK1
    ATI
    CLAN
    COPD
    CTGF
    CVC
    Apical Sodium Codependent Bile Acid Transporter Inhibitor
    Signal regulation kinase 1
    Apoptosis
    Type 1 angiotensin II receptor
    Conjugated Linoleic Acid
    Chronic obstructive pulmonary disease
    Tissue Growth Factor
    Unctive set
    Cenicriviroc
    DGAT
    DiacilGlycerol-Q-AcylTransferase
    DMSO
    Dimethyl Sulfoxide
    Petition 870190105365, of 10/18/2019, p. 78/148
    59/102
    DPP4 DiPeptidil Peptidase 4 ELISA Enzyme Linked Immunoassay AND OB Excess in Relation to Well-Being EOBHSA Excess over Higher Single Agent Welfare FABAC Bile Acid Conjugate Fatty Acid FBS Bovine Fetal Serum FGF Fibroblast Growth Factor FXR Farnesoid Receiver X GDF Growth Differentiation Factor GLP-1 Peptide 1 Similar to Glucagon GPCR Receptor Coupled to G Protein HBV Hepatitis B virus HCV Hepatitis C virus 15-HEPE 5-Hydroxy EicosaPentaEnoic Acid HIV Human immunodeficiency virus HSC Hepatic Star Cell IC50 Half of Inhibitory ConcentrationMaximum 1NOS Nitric Oxide Inducible Synthase IPF Idiopathic Pulmonary Fibrosis LO LipOxigenase LPS LipoPoliSsacarideo LT LeucoTrieno MAPK Mitogen-Activated Protein Kinase MMP-9 Metalloproteinase Matrix 9 MMPase Metalloproteinase Matrix NADPH Nicotinamide Adenine Dinucleotide Phosphate NAFLD Non-Alcoholic Fatty Liver Disease NASH Non-alcoholic steatohepatitis NF-kB Nuclear Factor-kappa B NOX NADPH oxidase
    Petition 870190105365, of 10/18/2019, p. 79/148
    60/102
    NSAIDS Non-Steroidal Anti-inflammatory Drugs PAIR Protease Activated Receiver PBC Primary Biliary Cholangitis PBS Phosphate Buffered Saline PDE PhosphoDiEsterase PDGF Platelet-Derived Growth Factor PFIC3 Familial Intrahepatic CholestasisProgressive type 3 PFOR Pyruvate: Ferredoxin OxidoReductase PPAR Peroxisome Proliferating Activated Receiver PPRE PPAR Response Elements PSC Primary Sclerosing Cholangitis ROCK Rho-associated protein kinase RTK Tyrosine Kinase Receptor SGLT Sodium Glucose Transport STAT Signal Transducers and ActivatorsTranscription TGFp Growth Transformation Factor β TGFBRI ΤΰΕβ type I receivers TGFBRII Type II ΤΰΕβ receptors THBS1 Thrombospondin 1 THR β Thyroid Hormone β Receptor TIMP MetaloProteinase Tissue Inhibitor 1 TLR-4 Receiver 4 Similar to Toll VAP-1 Vascular Adhesion Protein 1 VDR Vitamin D Receptor
    Figure 1: Effect of the combination of 1 mg / kg / day of ALS and 10 mg / kg / day of OCA in the measurement of fibrotic surface.
    Figure 2: Effect of the combination of 3 mg / kg / day of ALS and mg / kg / day of OCA on the measurement of fibrotic surface.
    Figure 3: Effect of the combination of 1 mg / kg / day of ALS and
    Petition 870190105365, of 10/18/2019, p. 80/148
    61/102 mg / kg / day of OCA in hepatic collagen.
    Figure 4: Effect of the combination of 3 mg / kg / day of ALS and mg / kg / day of OCA on hepatic collagen.
    Figure 5: Effect of the combination of 3 mg / kg / day of ALS and mg / kg / day of OCA on fibrosis markers.
    Figure 6: Differential antifibrotic effect of Elafibranor versus Cenicriviroc, and Bezafibrate in TGFb-induced hHSC
    [0199] HSCs devoid of serum were preincubated for 1 hour with Elafibranor (A), Cenicriviroc (B) or Bezafibrate (panPPAR-α / γ / δ) before activation with the profibrogenic cytokine TGFpl (1 ng / ml) .
    [0200] After 48 hours of incubation, g-SMA expression was measured by ELISA.
    [0201] The values obtained were transformed into a percentage of inhibition on the control of TGFpl. Data are presented as mean (triplicates) ± standard deviation (SD). Statistical analyzes were performed by unidirectional ANOVA followed by Bonferroni post-hoc tests, using the Sigma Plot 11.0 software. [*: p <0.05; **:
    p <0.01; ***: p <0.001 (comparison versus 1 ng / ml TGFpl group)]. The curve adjustment and the calculation of half of the maximum inhibitory concentration (IC50) were performed with XLFit software 5.3.1.3.
    Figure 7: Combination of Elafibranor with Cenicriviroc synergistically inhibits g-SMA in hHSC induced by TGFpl
    [0202] The combinations were tested in a dose-response matrix format and analyzed according to the Excess additivism in relation to Wellbeing (EOB) model.
    [0203] Elafibranor dilution series (line) and
    Petition 870190105365, of 10/18/2019, p. 81/148
    62/102
    Cenicriviroc (column) were prepared, including their respective DMSO controls.
    [0204] The resulting mixtures were added to serum-free HSC, 1 hour before activation with the pro-fibrogenic cytokine TGFpl (1 ng / ml).
    [0205] (A) Percentage of inhibition of α-SMA over TGFpl control for all combination pairs. Data are presented as an average of quadruplicates.
    [0206] (B) EOB scores were calculated as described in Materials and Methods. Any pair of compounds with EOB values> 10 was considered synergistic (colored from light gray to black). The total EOB score including all combinations was also calculated.
    [0207] (C) Data values derived from a synergistic combination pair were plotted in a bar graph representation. Data are presented as mean (quadruplicates) ± standard deviation (SD). Statistical analyzes were performed by unidirectional ANOVA followed by Bonferroni's post-hoc tests, using the
    software Sigma Plot 11.0. [*: p <0.05; **: p <0.01; · p <0.001product) (Comparation versus group of combination in Figure 8: Bezafibrato no synergizes with Cenicriviroc for
    reduce fibrosis in hHSC induced by TGFpl
    [0208] The combinations were tested in a dose-response matrix format and analyzed according to the Excess additivism model in relation to Well-being.
    [0209] Bezafibrate (row) and Cenicriviroc (column) dilution series were prepared, including their respective DMSO controls. The resulting mixtures
    Petition 870190105365, of 10/18/2019, p. 82/148
    63/102 were added to HSC without serum, 1 hour before activation with the pro-fibrogenic cytokine TGFpl (1 ng / ml).
    [0210] (A) Percentage of g-SMA inhibition in relation to the control of TGFpl.
    [0211] (B) Excess scores over BemEstar (EOB) were calculated as described in Materials and Methods. Any pair of compounds with EOB values> 10 was considered synergistic (colored from light gray to black). The total EOB score including all combinations was also calculated.
    Figure 9: Combinations of elafibranor with MSDC-0602, PXS4728A, Apararenone, CF-102, Vismodegib, PBI-4050, KD-025, DUR-928, VK-2809 and Emricasan synergistically inhibit g-SMA in hFSC induced by TGFplpl
    [0212] The combinations were tested in a dose-response matrix format and analyzed according to the Excess additivism in relation to Wellbeing (EOB) model. The percentages of α-SMA inhibition in relation to TGFpl control were plotted on a bar graph representation for representative synergistic combinations. Data are presented as mean (quadruplicates) ± standard deviation (SD). *: p <0.05; **: p <0.01; ***: p <0.001 using Unidirectional ANOVA and Fisher's Minimal Significant Difference (LSD) post-hoc test. MSDC = MSDC-0602,
    Figure 10: Combinations of elafibranor with CP-640186, GS0976 or JKB-121 (Nalmefene) synergistically inhibit collagen production in liver micro tissues
    The micro tissues were treated with a metabolic induction of NASH stimulation with or without elafibranor separately (white bar), compound (ii) separately (black bar) or
    Petition 870190105365, of 10/18/2019, p. 83/148
    64/102 a combination of both (gray bar). The combinations were tested in a dose-response matrix format and analyzed according to the Excess additivism in relation to Wellbeing (EOB) model. The percentages of inhibition in relation to NASH stimulus control were plotted on a bar graph representation for representative synergistic combinations. Data are presented as mean (triplicates) ± standard deviation (SD). *: p <0.05; **: p <0.01; ***; p <0.001 using Unidirectional ANOVA and Fisher's Minimal Significant Difference (LSD) post-hoc test. Figure 11: Combination of elafibranor with Gemcaben synergistically inhibits TNFa secretion in LPS-activated macrophages.
    [0213] The combinations were tested in a dose-response matrix format and analyzed according to the Excess additivism in relation to Wellbeing (EOB) model. The percentages of inhibition of TNFa secretion in relation to LPS control were plotted on a bar graph representation for representative synergistic combinations. Data are presented as mean (quadruplicates) ± standard deviation (SD). *: p <0.05; **: p <0.01; ***; p <0.001 using Unidirectional ANOVA and Fisher's Minimal Significant Difference (LSD) post-hoc test. Figure 12: Combinations of Elafibranor with CP640186, VK-2809 Apararenone (Apa) or Aramchol (Aram) synergistically inhibit the accumulation of fat in HepG2.
    [0214] The combinations were tested in a dose-response matrix format and analyzed according to the Excess additivism in relation to Wellbeing (EOB) model. The percentages of inhibition of fat accumulation in relation to
    Petition 870190105365, of 10/18/2019, p. 84/148
    65/102 FFA treated controls were plotted on a bar graph representation for representative synergistic combinations. Data are presented as mean (quadruplicates) ± standard deviation (SD). *: p <0.05; **: p <0.01; ***; p <0.001 using Unidirectional ANOVA and Fisher's Minimal Significant Difference (LSD) post-hoc test. Figure 13: Combination of elafibranor with MGL-3196 synergistically inhibits fat accumulation in Huh7 3D spheroid culture.
    The spheroids were treated with a metabolic NASH stimulus with or without elafibranor separately (white bar), MGL3196 separately (gray bar) or a combination of both (black bar). The measurement of lipid accumulation was performed as described in material and methods. Standard deviations are shown as error bars (n = 3). The calculated EOB value is shown at the top left. Significant differences (★ p <0.05; ★★ p <0.01 ***; p <0.001) following a unidirectional analysis of variance (ANOVA) and Fisher's Minimal Significant Difference test (LSD).
    Figure 14: Elafibranor (GFT505, 3 mg / kg / day) and selonsertib (SEL, 30 mg / kg / day) synergize to reduce fibrosis, tissue remodeling and inflammatory markers in mice with NASH (CDFF-fed mice).
    [0215] (A) Percentage of fibrosis surface was assessed by morphometric quantification of the positive picro-sirius area in relation to the liver section area.
    [0216] (B) Hepatic collagen content.
    [0217] (C) Plasma concentration of PIIINP, alternative markers of liver fibrosis.
    [0218] (D) Plasma TIMP1 concentration, markers
    Petition 870190105365, of 10/18/2019, p. 85/148
    66/102 alternative liver fibrosis,
    [0219] Collal expression (E), MMP2 (F), TGFpl (G) as markers of fibrosis and tissue remodeling, and TNFa (H) and CCR2 (I), markers of inflammation, were evaluated by quantitative PCR in time real.
    [0220] Data are expressed as mean ± SD. B p <0.05, α κ p <0.01, α BB p <0.001 using one-tailed Student t test with Welsh correction. HSA, Highest Single Agent Model.
    Figure 15: Elafibranor (GFT505, 1 or 3 mg / kg / day) and GKT-831 (GKT, 60 mg / kg / day) are synergized to reduce NASH and fibrosis in mice with NASH (CDFF-fed mice).
    [0221] (A) Percentage of fibrosis surface was assessed by morphometric quantification of positive picro-sirius area in relation to the liver section area.
    [0222] (B) Histological evaluation of inflammatory foci in 10 field areas for microscope (20X).
    [0223] (C) NAFLD activity score, assessed by calculating the sum of steatosis, ballooning and degrees of lobular inflammation (minimum 0 - maximum 8) according to the NASH Clinical Research Network (Kleiner 2005, Brunt 1999) .
    [0224] The data are expressed as mean ± SD. B p <0.05, 0a p <0.01, « c ° p <0.001 using one-tailed Student t test with Welsh correction. $ p <0.05, $$ p <0.01, $$$ p <0.001 using the one-tailed Mann-Whitney U test (nonparametric). HSA, Highest Single Agent Model.
    Figure 16: Elafibranor (GFT505, 1 mg / kg / day) and GS-0976 (GS, 30 mg / kg / day) synergize to reduce steatosis and weight
    Petition 870190105365, of 10/18/2019, p. 86/148
    67/102 body weight in mice with NASH (mouse fed with CDFF).
    [0225] (A) Degree of steatosis, assessed by histological exams in accordance with the Clinical Research Network for NASH instructions.
    [0226] (B) Hepatic triglyceride content.
    [0227] ( C) Loss of body weight after 8 weeks of treatment in comparison controls.[0228] The data are expressed as average ± SD. H p <0.05, aB p <0.01, ΒΚία p <0.001 using t test Student single tailSingle More with correctionHigh. of Welsh. HSA, Model Agent
    EXAMPLES
    Example 1: Study design combination therapy MATERIALS AND METHODS
    [0229] The compounds were dissolved in dimethyl sulfoxide (DMSO, catalog number Fluka 41640).
    1. Illustration in the hHSC model induced by TGF βΐHHSC culture
    [0230] Human primary liver stellate cells (hHSC) (Innoprot) were cultured in STeCM medium (ScienCell catalog number 5301) which was supplemented with 2% fetal bovine serum (FBS, ScienCell catalog number 0010) , 1% penicillin / streptomycin (ScienCell catalog number 0503) and stellate cell growth supplement (SteCGS; ScienCell category number 5352). Cell culture flasks were coated with Lysine Poli-L (Sigma catalog number P4707) for better adherence.
    Preparation of compositions
    Petition 870190105365, of 10/18/2019, p. 87/148
    68/102
    2-component combination matrix
    [0231] For these experiments, a chessboard-type matrix was generated. Component (ii) and ELA stocks were serially diluted in DMSO in a series of 5 points in a row (ELA) and a series in 11 points in a column (component (ii)) of a 96-well plate. Subsequently, the 5X11 combination matrix was generated by mixing 1: 1 of all concentrations of single agent. The test concentrations for each compound were chosen based on the respective IC50 of each compound as a single agent obtained by measuring the content of α-SMA in the HSC model stimulated with TGF-βΙ.
    Activation of hHSC with TGF-βΙ and compound treatment
    [0232] Human primary liver stellate cells (hHSC) (Innoprot) were cultured under standard conditions, as described above. The cells were subsequently plotted at a density of 2 x 10 4 cells / well in plates
    96 wells for The measure from a-SMA per ELISA. At the day next, the middle in culture cell phone was removed and at cells were washed with PBS (No. in category in
    Invitrogen 14190). The hHSC were depleted for 24 hours in a medium without serum and without SteCGS. For treatments with ALS, component (ii) and the respective ALS / component (ii) or combinations, the hHSC devoid of serum was pre-incubated for 1 hour with the compounds followed by the addition of profibrogenic TGF-βΙ stimuli (PeproTech n ° catalog 100-21, 1 ng / ml) in serum-free and SteCGS-free medium for an additional 48 hours.
    G-SMA ELISA
    [0233] The level of α-SMA was measured using an ELISA of
    Petition 870190105365, of 10/18/2019, p. 88/148
    69/102 sandwich. In short, the wells of an ELISA plate were first coated with the capture antibody (mouse monoclonal anti-ACTA2, Abnova) at 4 ° C overnight. After 3 washes in PBS + 0.2% Tween 20, a blocking solution consisting of PBS + 0.2% BSA was added for one hour before another wash cycle. Cell lysates were transferred to the wells for binding to the capture antibody for a period of 2 h at room temperature. After the washing procedure, the detection antibody (biotinylated mouse monoclonal anti-ACTA2, Abnova) was added for 2 hours at room temperature followed by 3 washes. For detection, an HRP-conjugated Streptavidin (R&D Systems category number DY998) was first applied for 30 min at room temperature. After washing, the HRP TMB substrate (BD, n ° 555214) was added and incubated for 7 minutes at room temperature in the dark. Upon oxidation, TMB forms a blue water-soluble reaction product that turns yellow with the addition of sulfuric acid (interruption of solution), allowing an accurate measurement of the intensity at 450nm with the use of a spectrophotometer. The color developed is directly proportional to the amount of a-SMA present in the lysate.
    2. Illustration in the model of HSC activation in 3D human liver microtissue
    Culture of human liver micro tissue in 3D
    [0234] Cryopreserved primary human hepatocytes (IPHH 11) and cryopreserved human non-parenchymal cells (NPCs, IPHN_11) were obtained from BioreclamationIVT. Primary human liver stellate cells
    Petition 870190105365, of 10/18/2019, p. 89/148
    70/102 cryopreserved (hHSC) were obtained from Innoprot. InSightTM 3D Human Liver Microwovens (MT-02-30295; InSphero AG) were produced with IPHH_11, IPHN_11 and hHSC on a 96 well suspended drop culture platform (Gravity PLUSTM). After the formation of micro-fabrics, they were transferred to a specific 96-well micro-fabric test and culture platform (Gravity TRAPTM). Maintenance and treatment of additional compounds were performed on Gravity TRAPTM plates. After tissue formation, the 3D micro-tissues were kept in InSight ™ 3D Human Liver Maintenance INF (hLiMM CS-07-001 b-01; InSphero AG) at 37 ° C in a C02 a cell culture incubator 5% humidified for 4 days. Half of the culture medium was replenished every 2 days.
    Preparation of compositions: 2-component combination matrix
    [0235] For these experiments, a chessboard-type matrix was generated. Component (ii) and ELA stocks were serially diluted in DMSO in a series of 2 points in a row (ELA) and a series in 3 points in a column (component (ii)) of a 96-well plate. Subsequently, the 2X3 combination matrix was generated by mixing 1: 1 of all concentrations of single agent. Metabolic stimulation of InSightTM 3D Human Liver Microwovens and compound treatment
    [0236] The InSightTM 3D human liver tissue (InSPhero) was grown under standard conditions, as described above. The microwovens were then stripped for 24 hours in serum-free medium. For ALS treatments, component (ii) and the respective combinations of
    Petition 870190105365, of 10/18/2019, p. 90/148
    71/102
    ELA / component (ii), serum-free microwovens were treated with both a metabolic induction of NASH stimulus and the compounds (Day 0) followed by the renewal of metabolic induction of NASH stimulus on Day 3 for a period of 3 more days. Supernatants for the Collal measurement were collected on Day 6.
    Collal ELISA
    [0237] Collal level was measured using a sandwich ELISA. In short, the wells of an ELISA plate were first coated with the capture antibody (Mouse Anti-Human Pro-Collagen I α 1 Capture Antibody, Elisa Pro-Collagen I al / COLIA1, DuoSet ELISA, R&D, n ° number: DY6220-05) to TA overnight. After 3 washes in PBS + 0.05% Tween 20, a blocking solution consisting of PBS + 1% BSA was added for one hour before another wash cycle. Culture supernatants were transferred to the wells to bind to the capture antibody for a period of 2 h at room temperature. After the washing procedure, the detection antibody (Biotinylated I α 1 Sheep Anti-Human Procollagen Detection Antibody) was added for 2 hours at room temperature followed by 3 washes. For detection, an HRP-conjugated Streptavidin was first applied for 20 min at room temperature. After washing, the HRP TMB substrate (BD, No. 555214) was added and incubated for 20 min at room temperature in the dark. Upon oxidation, TMB forms a blue water-soluble reaction product that turns yellow with the addition of sulfuric acid (interruption of solution), allowing an accurate measurement of the intensity at 450nm with the
    Petition 870190105365, of 10/18/2019, p. 91/148
    72/102 use of a spectrophotometer. The color developed is directly proportional to the amount of collal present in the supernatant.
    3. Illustration on LPS-activated macrophages
    Differentiation of THP-1 monocytes into macrophages
    [0238] THP-1 monocytes (ECACC No. 88081201) were seeded at a density of 25550 cells per well in a 384-well plate in RPMI1640 (Gibco, 21875) supplemented with 10% SVF and differentiated into macrophages using PMA ( 13 - Phorbol 12-myristate acetate, Sigma, P8139) at the final concentration of 100 ng / ml for 24 hours.
    Preparation of compositions: 2-component combination matrix
    [0239] For these experiments, a chessboard-type matrix was generated. Component and ELA stocks were serially diluted in DMSO in a series of 6 points in a row (ELA) and a series in 10 points in a column (component) of a 96-well plate. Subsequently, the 6X10 combination matrix was generated by mixing 1: 1 of all concentrations of single agent.
    Compound treatments and LPS stimulation
    [0240] After 24 h with PMA, the medium was removed and replaced with serum-free RPMI. For treatments with ALS, component (ii) and the respective ELA / component combinations, THP-1 macrophages devoid of serum were pre-incubated for 24 hours with the compounds followed by the addition of LPS lipopolysaccharides (100 ng / ml , E. coli 055 B5, Sigma, L6529) for an additional 6 hours.
    Quantification of human TNFα
    [0241] Human TNFα is quantified in the supernatant using
    Petition 870190105365, of 10/18/2019, p. 92/148
    73/102 time resolved homogeneous fluorescence (HTRF) technology (Cisbio 62HTNFAPEG), based on FRET technology. FRET (Fluorescence Resonance Energy Transfer) is based on the transfer of energy between two fluorophores, a donor and an acceptor, when it is close. The molecular interactions between biomolecules can be evaluated by coupling each partner with a fluorescent identification and by detecting the level of energy transfer (665 nm). Cell supernatant, sample or standard were distributed directly on the assay plate for detection by HTRF® reagents. The antibodies identified with the HTRF acceptor and donor were premixed and added in a single distribution step. The signal strength is proportional to the number of antigen-antibody complexes formed and, therefore, to the concentration of ΤΝΕα. The standard seven-point curve (from 39 pg / ml to 2500 pg / ml with human ΤΝΕα supplied) was obtained by adjusting the data with the 4-parameter logistic model.
    4. Illustration of fat-loaded hepatocytes (HepG2) HepG2 culture
    [0242] Human hepatocyte carcinomas were cultured in DMEM of 4.5 g / 1 glucose (Gibco category number 31053 which was supplemented with 10% fetal bovine serum (FBS, Gibco category number 10270) , 1% penicillin / streptomycin (Gibco category number 15140), 1% NEAA MEM (Gibco category number 11140), 1% LGlutamine (Gibco category number 25030), and 1% sodium pyruvate (Gibco category number 11360).
    Preparation of compositions: Combination matrix of 2
    Petition 870190105365, of 10/18/2019, p. 93/148
    74/102 components
    [0243] For these experiments, a chessboard-type matrix was generated. Component and ELA stocks were serially diluted in DMSO in a series of 5 points in a row (ELA) and a series in 11 points in a column (component) of a 384-well plate. Subsequently, the 5X11 combination matrix was generated by mixing 1: 1 of all concentrations of single agent.
    Preparation of free fatty acid (FFA)
    [0244] Oleic (No. 01383) and palmitic (P0500) acids were purchased from Sigma. FFA stock solutions (100 mM) were prepared in 0.1 M NaOH at 80 ° C. The working solutions of 4.5 mM palmitate / 10% bovine serum albumin (BSA) and 9 mM oleate / 10% BSA were prepared by complexing an appropriate volume of stock solution to 10% BSA (low content of FFA-free endotoxin; Sigma-Aldrich, Bornem, Belgium) in a 55 ° C water bath (15 min).
    Compound treatment and fat loading
    [0245] HepG2 was plated at a density of 40,000 cells / well in 384-well plates to assess the lipid droplet content. On the next day, the cell culture medium was removed, and the cells were washed with PBS (Invitrogen category number 14190). HepG2 was devoid for 24 hours in serum-free medium. For treatments with ALS, component (ii) and the respective ELA / component combinations, the serum-free HepG2 was pre-incubated for 24 hours with the compounds followed by the addition of a mixture of oleic: palmitic acids (2: 1 ) with a final concentration of 0.5 mM for an additional period of 24
    Petition 870190105365, of 10/18/2019, p. 94/148
    75/102 hours.
    Measurement of intracellular lipid droplets
    [0246] To measure the content of intracellular lipid droplets, the cells were brought to room temperature and washed with 40 μΐ of PBS. The cells were incubated for 30 min at room temperature with 40 μΐ of diluted Adipored reagent (2.5 μΐ of Adipored reagent per 200 μΐ of PBS) (Lonza, Walkersville, MD, USA). Relative fluorescence was measured (k excitation at 485 nm, k emission at 58 0 nm) using a fluorescence spectrometer (Spark Tecan category number 30086376 SN number 1801002745). The analyzes were performed in quadruplicates.
    5. Illustration in 3D spheroid culture of Huh7 3D spheroid culture of Huh7
    [0247] Huh7 cryopreserved were purchased from ECACC. The cells were grown in ULA plates (Costar), William's medium (Sigma) containing 10% FBS (Gibco) at 37 ° C in a humidified 5% CO2 cell culture incubator. The cells aggregated and formed spheroids within 5 days.
    Preparation of compositions: 2-component combination matrix
    [0248] For these experiments, a chessboard-type matrix was generated. Component (ii) and ELA stocks were serially diluted in DMSO in a series of 2 points in a row (ELA) and a series in 3 points in a column (component (ii)) of a 96-well plate. Subsequently, the 2X3 combination matrix was generated by mixing 1: 1 of all concentrations of single agent.
    Petition 870190105365, of 10/18/2019, p. 95/148
    76/102
    Metabolic stimulation of Huh7 3D spheroid culture and component treatment
    [0249] Huh7 3D spheroids were grown under standard conditions, as described above. They were then devoid of 24 hours in serum-free medium. For treatments with ALS, component (ii) and the respective ALS / component combinations (ii), serum-free spheroids were treated with both a NASH metabolic stimulus and the compounds (Day 0) followed by stimulus renewal metabolic rate of NASH and components on Day 4 for an additional 3 days. The spheroids were stained for lipid accumulation on Day 7.
    Lipid quantification & staining
    [0250] The intracellular accumulation of lipids was quantified using the AdipoRedTM Assay Reagent (Lonza). The spheroids were subjected to fluorescence assay quantification in Àexc: 485 nm and Àem: 572 nm, using fluorescence plate reader (TECAN).
    Results and discussion
    [0251] The abnormal persistence of differentiated myofibroblasts is a characteristic of many fibrotic diseases. Following liver damage, quiescent HSCs undergo an activation process that is characterized by a differentiation into myofibroblasts (α-SMA) -positives. The PPAR agonist elafibranor has antifibrotic activity in hHSC activated with the pro-fibrogenic cytokine TGFpl (Figure 9). In this document, it was surprisingly shown that the combinations of MSDC0602, PXS- 4728, Apararenone, CF-102 (Namodenoson),
    Petition 870190105365, of 10/18/2019, p. 96/148
    77/102
    Vismodegib, PBI-4050, emricasan, DUR-928, VK-2809 or KD-025 with elafibranor synergistically inhibited the production of a-SMA by HSC (Figure 9).
    [0252] Since the liver is made up of different cell types (hepatocytes, immune cells, HSC ...) and since the activation of HSC can result from different stimuli that involve other liver cells, a model of liver microtissue also was used for the combination test treatments in fibrosis. Treatment with a metabolic NASH stimulus increased the production of collagen by the tissue. In this model, Elafibranor synergized with CP-640186, GS-0976 and Nalmefene to inhibit collagen production (Figure 10).
    [0253] Taken together, these results show synergistic antifibrotic effects of the combinations of elafibranor with MSDC-0602, PXS-4728, Apararenone, CF-102 (Namodenoson), Vismodegib, PBI-4050, emricasan, DUR-928, VK-2809 , KD-025, CP-640186, GS-0976 or Nalmefene (JKB-121). [0254] Metabolic diseases, such as NAFLD / NASH, are associated with low-grade inflammation. The activation of immune cells produces cytokines that alter the metabolic functions of the liver and peripheral organs (adipose tissue, pancreas ...). Intestinal permeability, described in metabolic and liver diseases, results in an increase in circulating bacterial components (lipopolysaccharides or LPS) that activate macrophages in the liver and peripheral organs (adipose tissue). As PPARs have anti-inflammatory activities, we investigated the possibility that elafibranor and other compounds may inhibit the activation of macrophages by LPS. In a model of THP1 monocytes differentiated in
    Petition 870190105365, of 10/18/2019, p. 97/148
    78/102 macrophages, LPS treatment activates macrophages, as measured by TNFα secretion. Elafibranor (1 μΜ) separately inhibited TNFa by 21% (Figure 11). Surprisingly, the combination of elafibranor with gemcaben strongly inhibited TNFα secretion by 50% (Figure 11). Therefore, this result shows the ability of elafibranor to synergize with other compounds to reduce the inflammatory tonicity seen in various diseases, including NASH and metabolic diseases.
    [0255] NAFLD / NASH is characterized by the primary accumulation of fat in hepatocytes (steatosis), which induces lipotoxicity, leading to inflammation, cell death, tissue remodeling and, eventually, fibrosis. Since PPARa and PPARõ are known to induce fat oxidation and inhibit lipogenesis again, we wanted to see the possibility that elafibranor combined with other compounds prevent the accumulation of fat in hepatocytes. Therefore, HepG2 cells were treated with free fatty acid (FFA) to induce the accumulation of lipid droplets. In this model, elafibranor (10 μΜ) separately reduced fat accumulation by 20%. Unexpectedly, the reduction reached 40% when elafibranor was combined with CP-640186, VK-2809, Apararenona or Aramchol (Figure 12). An in vitro three-dimensional (3D) model of hepatocytes was also employed to address this issue, allowing for a more physiological reproduction of liver architecture. In this model, fat accumulation was obtained by treatment with a metabolic stimulus from NASH. Elafibranor (3 μΜ) reduced the fat content by 12% (Figure 13). Combination of elafibranor with MGL-3196 (1 μΜ) potentially reduced the
    Petition 870190105365, of 10/18/2019, p. 98/148
    79/102 hepatocyte lipid content by 28% (Figure 13), showing a synergistic effect when both drugs were used together.
    [0256] Taken together, these results show that elafibranor synergizes with CP-640186, VK-2809, Apararenone, Aramchol and MGL-3196, in particular to reduce steatosis.
    [0257] In conclusion, these results show the ability of elafibranor to synergize with MSDC-0602, PXS4728, Apararenone, CF-102 (Namodenoson), Vismodegib, PBI4050, emricasan, DUR-928, KD-025, CP-640186, GS -0976, Nalmefeno (JKB-121), VK-2809, MGL-3196 and Aramchol, in particular to reduce NAFLD.
    Example 2: combination of ELA and OCA
    Materials and methods
    Evaluation of Elafibranor, OCA and the combination of Elafibranor + OCA in a model of chronic CDAA + 1% cholesterol (12 weeks)
    [0258] The preventive effects of ALS separately, OCA separately and the combination of both were evaluated in a model of fibrosing NASH from rats fed a diet of CDAA + 1% cholesterol. Male Wistar rats weighing 150-175 g were fed a control diet (CSAA), CDAA diet + 1% cholesterol or CDAA diet + 1% cholesterol supplemented with Elafibranor 1 and 3 and 10 mg / kg / day, OCA 10 and 30 mg / kg / day or combined drugs (Elafibranor 1, 3 and 10 mg / kg / day combined with OCA 10 mg / kg / day) for 12 weeks.
    [0259] Body weight and food intake were monitored twice a week. On the last day of
    Petition 870190105365, of 10/18/2019, p. 99/148
    80/102 treatment, the rats were sacrificed after a 6 h fasting period. The liver was quickly excised for biochemical and histological studies.
    [0260] All procedures on animals were performed in accordance with standard protocols and in accordance with standard recommendations for the appropriate care and use of laboratory animals.
    Histology
    [0261] Tissue segmentation and imbibition:
    [0262] The liver slices were first fixed for 12 hours in 4% formalin solution. Then, the liver pieces were washed for 30 minutes in PBS and dehydrated in ethanol solutions (successive baths at 70, 80, 95 and 100% ethanol). The liver pieces were incubated in three different Xylene baths (SigmaAldrich catalog number 534056), followed by two baths in liquid paraffin (56 ° C). The liver pieces were then placed on shelves that were gently filled with Histowax® to completely cover the tissue.
    [0263] The paraffin blocks containing the pieces of fabric were removed from the shelves and stored at room temperature. The liver blocks were cut into 3 pm slices.
    Staining with Eosin / Hematoxylin
    [0264] The liver slices were dewaxed, rehydrated and incubated for 3 minutes in Mayer's Hematoxylin (Microm, catalog number F / C0303). Then, the liver sections were rinsed in water and incubated for 1 minute in Eosin G (VWR, category No. 1.09844.1000). The sections
    Petition 870190105365, of 10/18/2019, p. 100/148
    81/102 were rinsed in water, then dehydrated and assembled using CV Mount (Leica, catalog number 14046430011). Picro-sirius red coloring
    [0265] The liver sections were dewaxed, rehydrated and incubated for 15 minutes in a Fast Green FCF 0.1% solution (Sigma-Aldrich, catalog number F7258) before rinsing in a 0.5% acetic acid (Panreac, catalog number 131008.1611). Then, the liver slices were rinsed in water and incubated for 30 minutes in a 0.1% sirius red solution (Direct Red 80, Fluka cat. No. 43665) in saturated aqueous picric acid (cat. Sigma-Aldrich P6744). The sections were then dehydrated and assembled using the CV Mount medium (Leica, catalog number 14046430011).
    Histological exams
    [0266] A technician blind to the source of each liver specimen performed histological examinations. Virtual slides were generated using the 3D Histech Pannoramic 250 scanner. For each animal, a score summarizing the major histological lesions of NASH was assigned according to the NASH Clinical Research Network (Kleiner 2005, Brunt 1999). In short, steatosis, lobular inflammation and hepatocyte ballooning were scored. The NAFLD Activity Score (NAS Score) was established for each individual as the weighted sum of the steatosis grade (0-3), lobular inflammation (0-3) and ballooning lesions (0-2).
    [0267] Using the Quant Center software (3D Histech, including the Pattern Quant and Histo Quant modules), the areas with collagen color were quantified. In short, Pattern Quant was used to detect the fabric and measure its
    Petition 870190105365, of 10/18/2019, p. 101/148
    82/102 surface. Then, Histo Quant was used to detect the collagen content with color and measure its surface, based on a color limit method. The fibrosis area was then expressed as the percentage of the collagen surface for all tissue per animal.
    Measurement of hepatic collagen content
    [0268] The liver collagen content was determined using the appropriate QuickZyme kit (total collagen assay, catalog number QZB-totcol2). The assay is based on the detection of hydroxyproline, which is a non-proteinogenic amino acid mainly found in the triple collagen helix. Thus, hydroxyproline in tissue hydrolysates can be used as a direct measurement of the amount of collagen present in the tissue (without discrimination between pro-collagen, mature collagen and collagen degradation products).
    [0269] Complete hydrolysis of tissue samples in 6 M HCl at 95 ° C is required before dosing hydroxyproline.
    The test results ns i generation of a chromogen with a maximum absorbance The 570 nm. The results are expressed like mg collagen / g of liver. Alpha macroglobulin 2 (a2M)
    [0270] The plasma concentration of a2M was determined using an Abeam kit (catalog number abl57730), according to the manufacturer's instructions. In short, the microplate is pre-coated with an α 2M mouse specific antibody. Standards, controls and samples are then pipetted into the wells and any α 2M present in the plasma is bound by the immobilized antibody. After washing, a secondary antibody identified with horseradish peroxidase
    Petition 870190105365, of 10/18/2019, p. 102/148
    83/102 is added to the wells. After washing, a substrate solution is added to the wells. The enzyme reaction is stopped by adding the Stop Solution. The color intensity measured at 450 nm is proportional to the amount of α 2M bound in the initial step. The sample values are then deducted from the standard curve. The results are expressed in ng / ml.
    Pro-collagen III N-terminal pro-peptide (PIIINP)
    [0271] The plasma concentration of PIIINP was determined using an ELISA assay from Cloud-Clone Corp (catalog number SEA573Ra), according to the manufacturer's instructions. The microtiter plate is pre-coated with an antibody specific for PIIINP. Standards or samples are added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific for PIIINP. Next, Avidin conjugated to Horseradish Peroxidase (HRP) is added to each microplate well and incubated. After the TMB substrate solution is added, only those wells that contain PIIINP, biotin-conjugated antibody and enzyme-conjugated Avidin will exhibit a color change. The substrate reaction if the enzyme is terminated by the addition of sulfuric acid solution and the color change is measured spectrophotometrically at a wavelength of 450 nm ± 10 nm. The concentration of PIIINP in the samples is then determined by comparing the OD of the samples with the standard curve. The results are expressed in pg / ml.
    Analysis of hepatic gene expression
    [0272] Total RNA was used from rat livers using RNeasy Mini Kit (Qiagen) following the instructions of the
    Petition 870190105365, of 10/18/2019, p. 103/148
    84/102 manufacturer. The total RNA was reverse transcribed into cDNA using M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase) (Invitrogen category number 28025) in lx RT buffer (Invitrogen), 0.5 DTT mM (Invitrogen), 0.18 mM dNTPs (Promega), 200ng pdN6 (Amiersham) and 30U RNase inhibitor (Promega).
    [0273] Quantitative PCR was then performed using the CFX96 Touch ™ Real-Time PCR Detection System (Biorad). In short, PCR reactions were performed in 96-WP format at 25 μΐ of the total volume containing 1 μΐ of reverse transcription reaction, 0.5 μΐ of reverse and forward primers (10 pmol each) and 12.5 μΐ of 2X iQ SYBR Green Supermix (BioRad), using the following primer strings:
    Gene Direct Reverse RPLP0 CATGCTCAACATCTCCCCCTTCTCC(SEQ ID NO: 1) GGGAAGGTGTAATCCGTCTCCACAG(SEQ ID NO: 2) asthma(ACTA2) ACTGGGACGACATGGAAAAG(SEQ ID NO: 3) CATCTCCAGAGTCCAGCACA(SEQ ID NO: 4) TIMP1 TCCCCAGAAATCATCGAGAC(SEQ ID NO: 5) TCAGATTATGCCAGGGAACC(SEQ ID NO: 6) TGFB1 TGAGTGGCTGTC 1 1 1 1 GACG(SEQ ID NO: 7) TGGGACTGATCCCATTGATT(SEQ ID NO: 8) CCR5 CAGAACAGTCAACTTTGGGG(SEQ ID NO: 9) ACGTGGAAAATGAGGACTGC(SEQ ID NO: 10)
    [0274] Expression levels have been normalized with the
    Petition 870190105365, of 10/18/2019, p. 104/148
    85/102 use of RPLPO gene expression as a reference constitutive gene in samples. For each gene, standard curves were drawn by selecting the best points (at least three points) in order to have a PCR reaction efficiency close to 100% and a correlation coefficient close to 1. Expression levels were determined with the use of the standard curve equation for both the reference gene and the target gene (considering the specific PCR efficacy of each target gene).
    Results and discussion
    [0275] The results are reported in the table and in figures 1-5 below.
    GFT505 THE CA GFT505 +THE CA 3 mg / kg / d 10 mg / kg / d Fibrosis surface 34% ±17% *** 74% ±45% 19% ± 4%# Liver collagen content 45% ±12% *** 67% ±23% ** 34% ± 5%# «SMA mRNA level 6 6% ±27% 109% ±68% 39% ±18% # MRNA level ofTIMP1 78% ±23% 110% ±43% 46% ±13% ## TGFpl mRNA level 94% ±20% 110%± 23% 67% ±16% ## MRNA level ofCCR5 103% ±51% 81% ± 28% 56% ±17% #
    Percentage in relation to rats with untreated CDAA diet + 1% cholesterol ** p <0.01, *** p <0.001 vs CDAA group + 1% cholesterol (ANOVA + Bonferroni) # p <0 r 05 r ## p <0.01 vs the best single agent (Student's t-test) (+ inflammation marker)
    Petition 870190105365, of 10/18/2019, p. 105/148
    86/102
    [0276] Western lifestyle is invariably associated with a high incidence rate of non-alcoholic steatohepatitis (NASH), a chronic liver disease that often progresses to liver fibrosis and cirrhosis and can ultimately lead to hepatocellular carcinoma. Currently, there is no approved therapy for NASH. Drug combinations aimed simultaneously at multiple therapeutic targets have the potential to dramatically improve drug response and benefit the largest patient population. Drug combinations have been previously tested in other systemic diseases, such as hypertension, dyslipidemia or type 2 diabetes and have shown better control of the underlying diseases and decreased morbidity and mortality. In recent phase 2B studies, both Elafibranor (PPARa / δ agonist) and OCA have shown efficacy in end points of fibrosis and NASH. We wanted to compare its action on relevant NASH pathology results and look for therapeutic benefits of the combination.
    [0277] To achieve this goal, NASH histology and fibrosis were induced by feeding Wistar rats a diet defined in choline-deficient L-amino acid that was supplemented with cholesterol (CDAA / col diet). The animals in the intervention groups received either Elafibranor or OCA or both compounds for the entire study period. The development of NASH and fibrosis was assessed by histology. Additional molecular and biochemical analyzes were also performed on different relevant biomarkers.
    [0278] Wistar rats fed a diet of CDAA / col.
    Petition 870190105365, of 10/18/2019, p. 106/148
    87/102
    They developed histology related to NASH and fibrosis with high penetration of severe disease. Advanced steatosis, lobular inflammation and ballooning were present in all animals and the NAS score varied between 6 and 8. Hepatic histology (positive picro-sirius area) and biochemistry (hepatic collagen concentration) showed an average increase in four times the liver fibrosis content and the fibrosis score was 3 or 4 for all animals on the CDAA / c diet that did not receive drug treatment. The expression of genes related to inflammation, oxidative stress, tissue remodeling and fibrosis was increased and was consistent with gene signatures that were previously reported in NASH patients with severe disease.
    [0279] The administration of elafibranor and OCA separately resulted in a very significant attenuation of fibrosis development. Similar efficacy in fibrosis was seen in animals that received both compounds, although at significantly low doses. Damage to the hepatocyte, as judged by ballooning, was prevented or mitigated by elafibranor, in a dose-dependent manner. Instead, OCA showed only partial ballooning attenuation at the doses that were used in this study. Lobular inflammation was mitigated by elafibranor in a dose-dependent manner and, to a lesser extent, with OCA. Finally, the administration of either drug candidate separately partially attenuated the increase in markers of tissue remodeling, inflammation and oxidative stress and the combination of both compounds was more effective compared to any single agent.
    Petition 870190105365, of 10/18/2019, p. 107/148
    88/102
    [0280] Therefore, it was shown in the present document that the synergistic action of elafibranor and OCA on liver fibrosis in the NASH model induced by the CDAA / c diet produced a comparable therapeutic benefit at significantly lower doses for both drug candidates, compared to any single agent. From this study, it is credibly expected that the doses of both drug candidates can be reduced by a factor of at least 1.5, 2, 2.5 or even at least 3 to obtain results similar to the initial dose of each compound used individually. In addition, elafibranor showed an evident protective effect on liver damage. The effects of OCA on ballooning and lobular inflammation were quite modest in this model. From this study, it can be concluded that the combination of Elafibranor / OCA would benefit a larger population of patients and the reduction of the associated therapeutic dose would decrease the incidence of adverse effects to drugs.
    Example 3: combination of ALS and CVC MATERIALS AND METHODS
    [0281] The compounds were dissolved in dimethyl sulfoxide (DMSO, catalog number Fluka 41640). CVC was obtained commercially from CLINISCIENCES (Ref: A13643-10, Lot number: 497223-25-3)
    [0282] Bezafibrato was synthesized in Genfit.
    HHSC Culture
    [0283] Human primary hepatic stellate cells (hHSC) (Innoprot) were cultured in STeCM medium (ScienCell catalog number 5301) which was supplemented with 2% fetal bovine serum (FBS, ScienCell catalog number 0010) ,
    Petition 870190105365, of 10/18/2019, p. 108/148
    89/102% penicillin / streptomycin (ScienCell catalog number 0503) and star cell growth supplement (SteCGS; ScienCell category number 5352). Cell culture flasks were coated with Lysine Poli-L (Sigma catalog number P4707) for better adherence.
    Preparation of compositions
    2-component combination matrix (Bezafibrato / CVC)
    [0284] For these experiments, a chessboard-type matrix was generated. CVC and Elafibranor stocks were serially diluted in DMSO in a series of 5 points in a row (Elafibranor) and a series in 6 points in a column (Cenicriviroc) of a 96-well plate. Subsequently, the 6X7 combination matrix was generated by mixing 1: 1 of all concentrations of single agent. The test concentrations for each compound were chosen based on the respective IC50 of each compound as a single agent obtained by measuring the content of α-SMA in the HSC model stimulated with TGF-βΙ.
    Activation of hHSC with TGF-βΙ and compound treatment
    [0285] Human primary liver stellate cells (hHSC) (Innoprot) were grown under standard conditions, as described above. The cells were subsequently plated at a density of 2 x 10 4 cells / well in 96-well plates for the measurement of α-SMA by ELISA.
    [0286] The next day, the cell culture medium was removed and the cells were washed with PBS (Invitrogen category number 14190). The hHSC were depleted for 24 hours in a medium without serum and without SteCGS. For treatments with CVC, Elafibranor, Bezafibrato and
    Petition 870190105365, of 10/18/2019, p. 109/148
    90/102 combinations in pairs of CVC / Elafibranor and CVC / Bezafibrate, hHSC devoid of serum were pre-incubated for 1 hour with the compounds before the addition of TGF-βΙ of pro-fibrogenic stimuli (PeproTech catalog number 100- 21, 1 ng / ml) in serum-free and SteCGS-free medium for an additional 48 hours.
    G-SMA ELISA
    [0287] The level of α-SMA was measured using a sandwich ELISA. In short, the wells of an ELISA plate were first coated with the capture antibody (mouse monoclonal anti-ACTA2, Abnova) at 4 ° C overnight. After 3 washes in PBS + 0.2% Tween 20, a blocking solution consisting of PBS + 0.2% BSA was added for one hour before another wash cycle. Cell lysates were transferred to the wells for binding to the capture antibody for a period of 2 h at room temperature. After the washing procedure, the detection antibody (biotinylated mouse monoclonal anti-ACTA2, Abnova) was added for 2 hours at room temperature followed by 3 washes. For detection, an HRP-conjugated Streptavidin (R&D Systems category number DY998) was first applied for 30 min at room temperature. After washing, the HRP TMB substrate (BD, n ° 555214) was added and incubated for 7 minutes at room temperature in the dark. Upon oxidation, TMB forms a blue water-soluble reaction product that turns yellow with the addition of sulfuric acid (interruption of solution), allowing an accurate measurement of the intensity at 450nm with the use of a spectrophotometer. The developed color is directly
    Petition 870190105365, of 10/18/2019, p. 110/148
    91/102 proportional to the amount of α-SMA present in the lysate.
    Determination of synergism by Excess in relation to Well-Being (EOB) method
    [0288] The values obtained in the a-SMA ELISA assays were first transformed into percent inhibitions under TGF-βΙ control. Then, using this percentage of inhibitions, the EOB (Excess in relation to Bemestar) was determined to define the synergistic effects of drug combinations. The expected Wellbeing additivism score (E) was first determined by the equation:
    [0289] E = (A + B) - (A x B) where A and B are the percentage inhibition of Elafibranor (A) (or Bezafibrate) and Cenicriviroc (B) at a given dose. The difference between the expectation of Satisfaction and the observed inhibition of CVC / Elafibranor (or Bezafibrate) combined in the same dose is the Excess over Satisfaction score.
    Exceeding Satisfaction score = 0 indicates that the combination treatment is additive (as expected for the purposes of independent pathways);
    Excess score in relation to Well-being> 0 indicates greater than additive activity (synergy); and
    Excess score in relation to Well-being <0 indicates that the combination is less than additive (antagonism).
    [0290] For the combinations Elafibranor + CVC and Bezafibrato + CVC, an additional Total Satisfaction score was calculated by adding the entire EOB.
    [0291] In order to validate the synergism, the corresponding experimental values to overcome the EOB score for the CVC / Elafibranor agonists combination were
    Petition 870190105365, of 10/18/2019, p. 111/148
    92/102 plotted on a bar chart.
    [0292] The significance of the differences observed between CVC / Elafibranor or CVC / Bezafibrate on the highest single agent was determined by a student's t-test [*: p <0.05; **: p <0.01; ***: p <0.001] Results and conclusions:
    [0293] The abnormal persistence of differentiated myofibroblasts is a characteristic of many fibrotic diseases.
    [0294] Following the liver injury, quiescent HSCs undergo an activation process that is characterized by differentiation into myofibroblasts (α-SMA) -positives.
    [0295] PPAR agonist elafibranor reveals an antifibrotic activity in hHSC activated with the pro-fibrogenic cytokine TGFpl. The α-SMA marker was reduced by 80% with an IC50 of 3.17 μΜ (Fig. 6A). However, other PPAR agonists such as Bezafibrate showed a weak antifibrotic profile (Fig. 6C), suggesting that PPAR agonists are not equivalent in terms of their antifibrotic properties. The CVC alone does not show a significant effect at all doses in TGFp-activated HSC (Fig. 6B). In order to assess whether a combination of Elafibranor and CVC could synergistically reduce fibrosis, combination matrix experiments were performed on TGFp-induced HSCs. In short, the CVC and Elafibranor solutions were serially diluted in a chessboard format generating a matrix of combinations 42 that covers a wide range of Elafibranor / CVC ratios. Synergy was first determined by calculating Excess scores in relation to Well-Being.
    Petition 870190105365, of 10/18/2019, p. 112/148
    93/102
    These experiments revealed that Elafibranor could synergize with CVC to reduce the production of α-SMA in activated HSCs (Figs. 7A and 7B). One of the best examples of synergy is shown in Fig. 7C with 5 μΜ of each compound. Although 5 μΜ of CVC alone does not show any antifibrotic activity, its addition to 5 μΜ of Elafibranor could significantly increase the activity of Elafibranor and achieved up to 60% inhibition (compared to 40% with 5 μΜ of Elafibranor ). In contrast, the combination of CVC with Bezafibrato revealed much lower EOB scores (Fig. 8A and 8B) and none of the combinations produced statistically significant results.
    [0296] In conclusion, the applicant revealed unexpected antifibrotic activities for a combination of ALS and CVC. These results suggest that a combination of a compound of Formula (I) with a CVC can be synergistic and can provide therapeutic benefits in multiple types of diseases, such as fibrotic diseases.
    Example 4: combinations of elafibranor with selonsertib (SEL), GKT-831 or GS-0976 (GS): evaluation in a mouse fibrous NASH model (8 weeks)
    [0297] The preventive effects of combinations of elafibranor with selonsertib, GKT-831 or GS-0976 were evaluated in mice fed a diet defined in 1-amino acid (CDAA), deficient in choline, supplemented with 2% cholesterol, diet with 2% cholesterol. 30% milk fat and high fructose corn syrup 55 (55% fructose / 45% glucose for a final concentration of 42 g / 1) in drinking water (Mells et al. J Nutr Biochem 2015)
    Petition 870190105365, of 10/18/2019, p. 113/148
    94/102 (CDFF diet). Male C57BI / 6J mice 5-6 weeks of age were fed a control diet (CSAA) (n = 4), CDFF (n = 12), or CDFF supplemented with elafibranor (1 or 3 mg / kg) / day), selonsertib (30 mg / kg / day), GKT-831 (60 mg / kg / day) or GS-0976 (10 mg / kg / day) separately or in combination (n = 8 per group) by 8 weeks.
    [0298] Body weight and food and water intake were monitored twice a week. On the last day of treatment, plasma samples were obtained from retro-orbital blood sampling and the mice were sacrificed after a 6 h fasting period. The liver was quickly excised for biochemical and histological analysis. All procedures on animals were performed according to standard protocols and according to standard recommendations for the appropriate care and use of laboratory animals.
    Histology
    Soaking and dividing tissue
    [0299] The liver slices were fixed in a 4% formalin solution. Then, the liver pieces were washed for 30 minutes in PBS and dehydrated in ethanol solutions (successive baths at 70, 80, 95 and 100% ethanol). The liver pieces were incubated in three different Xylene baths (Honeywell catalog number 534056), followed by two baths in liquid paraffin (59 C). The liver pieces were then placed on shelves that were gently filled with Histowax® to completely cover the tissue.
    [0300] The paraffin blocks containing the pieces of
    Petition 870190105365, of 10/18/2019, p. 114/148
    95/102 fabrics were removed from the shelves and stored at room temperature. The liver blocks were cut into 3 pm slices.
    Hematoxylin / Eosin / Safranin staining
    [0301] The liver sections were deparaffinized, rehydrated and incubated for 3 minutes in Mayer's Hematoxylin (Microm, catalog number F / C0303). Then, the liver slices were rinsed in water and incubated for 1 minute in a solution of 0.5% alcoholic Eosin Y (VWR, catalog number 1.02439.0500) and 0.5% Erythrosine (VWR, catalog number 1.15936.0010), and rinsed with ethanol. The cuts were then incubated for 2 minutes in Safranína and were finally dehydrated and assembled using the CV Assembly medium (Leica, catalog number 046430011).
    Red coloring Pícro-Siríus
    [0302] The liver sections were dewaxed, rehydrated and incubated for 15 minutes in a Fast Green FCF 0.1% solution (Sigma-Aldrich, catalog number F7258) before rinsing in a 0.5% acetic acid (Panreac, catalog number 131008.1611). Then, the liver slices were rinsed in water and incubated for 30 minutes in a 0.1% sirius red solution (Direct Red 80, Fluka cat. No. 43665) in saturated aqueous picric acid (cat. Sigma-Aldrich P6744). The sections were then dehydrated and assembled using the CV Mount medium (Leica, catalog number 14046430011).
    Histological exams
    [0303] A technician blind to the source of each liver specimen performed histological examinations. Virtual slides were generated using the 3D Histech Pannoramic 250 scanner. For
    Petition 870190105365, of 10/18/2019, p. 115/148
    96/102 each animal, a score summarizing the major histological lesions of NASH was assigned according to the Clinical Research Network for NASH (Kleiner 2005, Brunt 1999). In short, steatosis, lobular inflammation and hepatocyte ballooning were scored. The NAFLD Activity Score (NAS) was established for each individual as the weighted sum of the steatosis grade (0-3), lobular inflammation (0-3) and ballooning lesions (0-2).
    [0304] Using Quant Center software (3D Histech, including the Pattern Quant and Histo Quant modules), the areas with collagen color were quantified. In short, Pattern Quant was used to detect the fabric and measure its surface. Then, Histo Quant was used to detect the collagen content with color and measure its surface, based on a color limit method. The fibrosis area was then expressed as the percentage of the collagen surface for all tissue per animal.
    Biochemical analysis of livers
    Measurement of hepatic collagen content
    [0305] The liver collagen content was determined using the appropriate QuickZyme kit (total collagen assay, catalog number QZB-totcol2). The assay is based on the detection of hydroxyproline, which is a non-proteinogenic amino acid mainly found in the triple collagen helix. Thus, hydroxyproline in tissue hydrolysates can be used as a direct measurement of the amount of collagen present in the tissue (without discrimination between pro-collagen, mature collagen and collagen degradation products).
    [0306] Complete hydrolysis of tissue samples in HCl
    Petition 870190105365, of 10/18/2019, p. 116/148
    97/102 at 6 M at 95 ° C is required before dosing hydroxyproline. The test results in the generation of a chromogen with a maximum absorbance at 570 nm. The results are expressed as mg of collagen / g of liver.
    Measurement of hepatic triglyceride content
    [0307] Approximately 100 mg of frozen liver tissue was homogenized with a tissue homogenizer (Precellys® 24, Bertin Technologies, France) in 150 mM NaCI buffer, containing 15.4 mM NaN3. The lipid fractions in the homogenates were extracted with chloroform-methanol (2: 1, v / v) followed by the measurement of triglycerides (Biolabo category number 80019).
    Plasma Procollagen III N-terminal Pro-peptide measurement (PIIINP)
    [0308] The plasma concentration of PIIINP was determined using an ELISA assay from Cloud-Clone Corp (catalog number SEA573Mu), according to the manufacturer's instructions. The microtiter plate is pre-coated with an antibody specific for PIIINP. Standards or samples are added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific for PIIINP. Next, Avidin conjugated to Horseradish Peroxidase (HRP) is added to each microplate well and incubated. After the TMB substrate solution is added, only those wells that contain PIIINP, biotin-conjugated antibody and enzyme-conjugated Avidin will exhibit a color change. The substrate reaction if the enzyme is terminated by the addition of sulfuric acid solution and the color change is measured spectrophotometrically at a wavelength of
    Petition 870190105365, of 10/18/2019, p. 117/148
    98/102
    450 nm ± 10 nm. The concentration of PIIINP in the samples is then determined by comparing the OD of the samples with the standard curve. The results are expressed in pg / ml.
    Plasma tissue inhibitor of metalloproteinase 1 matrix (TIMP-1)
    [0309] Plasma levels of TIMP-1 were measured using a quantitative sandwich ELISA assay from R&D Systems (catalog number MTM100) according to the experimental protocol PRO_LIDO_000020. In short, a TIMP-1 mouse-specific monoclonal antibody was pre-coated on a microplate. Standards, controls and samples are pipetted into the wells and any TIMP-1 mice present are bound by the immobilized antibody. After washing any unbound substances, a polyclonal antibody bound to a mouse TIMP-1 specific enzyme is added to the wells. After washing to remove any unbound antibody-enzyme reagent, a substrate solution is added to the wells. The enzymatic reaction produces a blue product that turns yellow when the stop solution is added. The intensity of the measured color is proportional to the amount of TIMP-1 of the mouse turned on in the initial step. The sample values are then calculated from the standard curve. The results are expressed in pg / ml.
    Analysis of hepatic gene expression
    [0310] Total RNA was used from mouse livers with the use of RNeasy Mini Kit (Qiagen) following the manufacturer's instructions. The total RNA was reverse transcribed into cDNA using M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase) (No.
    Petition 870190105365, of 10/18/2019, p. 118/148
    99/102 category of Invitrogen 28025) in lx RT buffer (Invitrogen), 0.5 mM DTT (Invitrogen), 0.18 mM dNTPs (Promega), 200ng pdN6 (Amersham) and 30U RNase inhibitor (Promega).
    [0311] Quantitative PCR was then performed using the CFX96 Touch ™ Real-Time PCR Detection System (Biorad). In short, PCR reactions were performed in 96-WP format at 25 μΐ of the total volume containing 1 μΐ of reverse transcription reaction, 0.5 μΐ of reverse and forward primers (10 pmol each) and 12.5 μΐ of 2X iQ SYBR Green Supermix (BioRad), using the following primer strings:
    Gene Direct Reverse GAPDH TATGACTCCACTCACGGCAA(SEQ ID NO: 11) TCCACGACATACTCAGCACC(SEQ ID NO: 12) Collal AGGCGAACAAGGTGACAGAG(SEQ ID NO: 13) GCCAGGAGAACCAGCAGAG(SEQ ID NO: 14) TGFpl TTGCTTCAGCTCCACAGAGA(SEQ ID NO: 15) TGGTTGTAGAGGGCAAGGAC(SEQ ID NO: 16) CCR2 TAATATGTTACCTCAGTTCATCCACGG(SEQ ID NO: 17) TGCTCTTCAGC1 1 1 1 1ACAGCCTATC(SEQ ID NO: 18) MMP2 TCCCTAAGCTCATCGCAGAC(SEQ ID NO: 19) GCTTCCAAACTTCACGCTCT(SEQ ID NO: 20) TNFa CGTGGAACTGGCAGAAGAGG(SEQ ID NO: 21) AGACAGAAGAGCGTGGTGGC(SEQ ID NO: 22)
    [0312] The expression levels were normalized with the use of the expression of the GAPDH gene as a constitutive gene of
    Petition 870190105365, of 10/18/2019, p. 119/148
    100/102 reference on samples. For each gene, standard curves were drawn by selecting the best points (at least three points) in order to have a PCR reaction efficiency close to 100% and a correlation coefficient close to 1. Expression levels were determined with the use of the standard curve equation for both the reference gene and the target gene (considering the specific PCR efficacy of each target gene). Results and conclusions:
    [0313] In recent clinical studies, elafibranor, selonsertib, GKT-831 and GS-0976 have shown efficacy at NASH and fibrosis endpoints. We wanted to compare its action on relevant NASH pathology results and look for therapeutic benefits of the combination. To achieve this goal, NASH was induced by feeding C57BI / 6J mice with a choline-deficient Lamino acid diet supplemented with cholesterol and milk fat and high fructose corn syrup in drinking water (CDFF diet). The animals in the intervention groups received elafibranor, selonsertib, GKT-831 or GS-0976 separately or in combination with elafibranor, throughout the study period. The development of NASH was evaluated by histology and biochemical measurements and hepatic expression of genes involved in pathways relevant to the pathology of NASH.
    [0314] CDFF-fed mice developed NASH with high penetration of severe disease. Advanced steatosis and lobular inflammation were present in all animals, resulting in a high NAS score of 6 or 7
    Petition 870190105365, of 10/18/2019, p. 120/148
    101/102 (Figure 15-C). Gene expression related to fibrogenesis, tissue remodeling and inflammation was increased and was consistent with gene signatures that were previously reported in NASH patients with severe disease (Figure 14-E-1).
    [0315] In this model, elafibranor (3 mg / kg / day) improves the histology of NASH, reducing steatosis and hepatic lobular inflammation, resulting in an overall reduction in the NAFLD activity score (not shown). Elafibranor also decreases the expression of genes related to inflammation, tissue remodeling and fibrogenesis (Figure 14-E1), resulting in a marked reduction in liver fibrosis assessed by histology, liver collagen content and release of PIIINP and TIMP-1 in the blood ( Figure 14-AD).
    [0316] Selonsertib (30 mg / kg / day) separately improved liver fibrosis in this model, although to a lesser extent than elafibranor (Figure 14). The combination of elafibranor (3 mg / kg / day) and selonsertib (30 mg / kg / day) resulted in a beneficial synergistic effect on liver fibrosis (assessed by histology, liver collagen content and release of PIIINP and TIMP-1) as in the hepatic expression of genes involved in fibrogenesis, remodeling and tissue inflammation (Figure 14).
    [0317] GKT-831 (60 mg / kg / day) separately had no beneficial effect on NASH and fibrosis in this model. However, when combined with an insufficient dose of elafibranor (1 mg / kg / day), it reduced hepatic inflammatory infiltrates, NAFLD activity score and fibrosis (Figure 15).
    Petition 870190105365, of 10/18/2019, p. 121/148
    102/102
    [0318] Treatment with GS-0976 (30 mg / kg / day) had a mild beneficial effect in relation to liver fat and body weight in this model (Figure 16). However, the combination with elafibranor in an insufficient dose (1 mg / kg / day) led to a synergistic effect in burning total body fat, leading to a 20% loss of body weight and a notable decrease in liver steatosis and triglyceride content (Figure 16).
    [0319] In conclusion, synergistic effects were found between elafibranor and MSDC-0602, PXS-4728, MT-3995 (Apararenone), CF-102 (Namodenoson), Vismodegib, PBI-4050, Gemcabeno, CP-640186, GS-0976 , JKB-121 (Nalmefene), VK2809, MGL-3196, Aramchol, Emricasan, DUR-928 (25-hydroxycholesterol-3-sulfate), Selonsertib, KD-025 or GKT831.
    REFERENCES
    Brunt EM et al, 1999, Ami J Gastroenterol; 94 (9): 2467-74 Kleiner DE et al, 2005, Hepatology; 41 (6): 1313-21
    权利要求:
    Claims (7)
    [1]
    1. Combination product characterized by comprising:
    (i) a compound of Formula (I), or a pharmaceutically acceptable salt or solvate thereof:
    (i) where:
    Y1 represents a halogen, a group Ra or Ga-Ra;
    A represents a CH = CH group or a CH2-CH2 group;
    Y2 represents a Gb-Rb group;
    Ga and Gb, identical or different, represent an oxygen or sulfur atom;
    Ra represents a hydrogen atom, an unsubstituted (C1-C6) ayl group, an (C6-C14) aryl group or an (C1-C6) ayl group that is replaced by one or more halogen atoms, a (C1 -C6) alkoxy or a (C1-C6) alkylthio group, (C3-C14) cycloalkyl groups, (C3-C14) cycloalkylthio groups or heterocyclic groups;
    Rb represents a (C1-C6) aiquyl group substituted by at least one -COORc group, where Rc represents a hydrogen atom or a (C1-C6) aiquyl group that is substituted or not by one or more halogen atoms, groups (C3-C14) cycloalkyl or heterocyclic groups; and
    Petition 870190105365, of 10/18/2019, p. 123/148
    [2]
    2/7
    Y4 and Υ5, identical or different, representing a (C1-C6) alkyl group that is or is not substituted by one or more halogen atoms, (C3-C14) cycloalkyl groups or heterocyclic groups. and
    (ii) an agent anti-NASH, antifibrotic or anti-cholestatic.2. Product of combination, according The
    claim 1, characterized by the fact that component (i) is elafibranor or a pharmaceutically salt
    acceptable.3. Product in combination, according to claim 1 or 2, characterized by the fact that the component (ii) is one ASK1 inhibitor, a NOXI and NOX4 double, an inhibitor in VAP-1, stearoyl CoA inhibitors
    desaturase-1 / a fatty acid bile acid conjugate, a GPR84 antagonist / immunomodulator or FFAR1 agonist, an mTOR modulator or insulin sensitizer, a THRp agonist, a Hedgehog signaling pathway inhibitor, a receptor agonist of adenosine A3, an aldosterone receptor antagonist, a TLR-4 antagonist, a caspase inhibitor, a ROCK2 inhibitor or a nuclear receptor ligand.
    [3]
    3 (PFIC3), inflammatory bowel diseases, Crohn's disease, ulcerative oolitis, keloid, myocardial infarction, scleroderma / systemic sclerosis, inflammatory diseases, neurodegenerative diseases, cancers, liver cancer, hepatocellular carcinoma, gastrointestinal cancer, gastric cancer, meningioma associated with neurofibromatosis, pancreatic neuroendocrine tumors, pancreatic exocrine tumors, leukemia, myeloproliferative / myelodysplastic diseases, mastoeitosis, dermatofibrosarcoma, solid tumors including breast, lung, thyroid or colorectal cancer, prostate cancer, fibrosis or any liver or fibrosis or cirrhosis metabolic disease-induced liver cirrhosis, NAFLD-induced fibrosis or cirrhosis, NASH-induced fibrosis or cirrhosis, alcohol-induced fibrosis or liver cirrhosis, drug-induced fibrosis or liver cirrhosis induced by infectious agent, fibrosis or liver cirrhosis induced by parasite infection , fibrosis or liver cirrhosis induced by bacterial infection, fibrosis or cirrhosis induced by viral infection,
    fibrosis or cirrhosis hepatic induced per infection per HBV, fibrosis or cirrhosis hepatic induced per infection per HCV, fibrosis or cirrhosis hepatic induced per infection per HIV, fibrosis or cirrhosis hepatic induced per infection double . per HCV and HIV, fibers and or radiation-induced cirrhosis or
    chemotherapy, fibrosis of the biliary tract, fibrosis or liver cirrhosis due to any chronic cholestatic disease, intestinal fibrosis of any etiology, fibrosis induced by Crohn's disease, fibrosis induced by ulcerative colitis, fibrosis of the intestine (eg intestine
    Petition 870190105365, of 10/18/2019, p. 127/148
    3 / Ί
    [4]
    Combination product according to any one of claims 1 to 3, characterized in that component (ii) is Selonsertib, GKT-831, PXS-4728A, Aramchol, PBI-4050, MSDC-0602k, VK- 2809, MGL-3196, Vismodegib, CF-102 (Namodenoson), MT-3995 (Apararenone), JKB-121 (Nalmefeno), emricasan, KD-025 and DUR-928 or pharmaceutical salt thereof.
    Petition 870190105365, of 10/18/2019, p. 124/148
    [5]
    5/7
    Combination product according to any one of claims 1 to 4, characterized in that component (ii) is GKT-831, aramchol, SHP-625, emricasan, saroglitazar, IMM-124-E, GS- 9674, NGM-282, A-4250, GR-MD02, GS-4997, F-351, solithromycin, remogliflozin, BTT1023, IVA-337 (Lanifibranor), JKB-121, KD-025, MSDC-0602, PBI-4050 , PEG-FGF21, tipelukast, VK-2809, MGL-3196, GS0976, pentasa, RG-125, volixibat, pioglitazone, semagglutide, GSK2330672 or MBX-8025.
    [6]
    6 / Ί thin), colon fibrosis, stomach fibrosis, skin fibrosis, fibrosis of the epidermis, fibrosis of the endodermis, fibrosis due to scleroderma / systemic sclerosis, pulmonary fibrosis, fibrosis following chronic inflammatory diseases of the airways, such as COPD, asthma, emphysema, smoker's lung, tuberculosis, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), cardiac fibrosis, renal fibrosis, nephrogenic systemic fibrosis, muscle fibrosis, soft tissue fibrosis (for example, mediastinum or retroperitoneum) fibrosis, marrow fibrosis bone, joint fibrosis, tendon fibrosis, cartilage fibrosis, pancreas fibrosis, fibrosis of the uterus, fibrosis of the nervous system, fibrosis of the testis, fibrosis of the ovary, fibrosis of the adrenal gland, arterial fibrosis, venous fibrosis, fibrosis, fibrosis endomyocardial, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis, progressive massive fibrosis (a complication of pneumoconiosis in people who work with coal), proliferative fibrosis erative, neoplastic fibrosis, peri-implant fibrosis and asbestosis, arthrofibrosis, adhesive capsulitis.
    13. Combination product for use, according to claim 10, characterized by the fact that the disease is selected from the group consisting of metabolic liver diseases, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH) , drug-induced liver disease, alcohol-induced liver disease, infectious agent-induced liver disease, inflammatory liver disease, immune-mediated liver disease, dyslipidemia, cardiovascular disease, restenosis, syndrome X, metabolic syndrome, diabetes, obesity, hypertension,
    Petition 870190105365, of 10/18/2019, p. 128/148
    Combination product according to any one of claims 1 to 5, the combination product being characterized by being a composition comprising components (i) and (ii) and a pharmaceutically acceptable carrier.
    Combination product according to any one of claims 1 to 6, the combination product being a kit of parts comprising components (i) and (ii), for sequential, separate or simultaneous use.
    Combination product according to any one of claims 1 to 7, characterized in that the components (i) and (ii) are formulated in an injectable suspension, a gel, an oil, a pill, a tablet, a suppository, a powder, a capsule, an aerosol, an ointment, a cream, a plaster or galenic form media for prolonged and / or slow release.
    Combination product according to any one of claims 1 to 8, characterized in that it is for use as a medicament.
    10. Combination product, according to any
    Petition 870190105365, of 10/18/2019, p. 125/148 ^ / Ί of claims 1 to 8, characterized in that it is for use in a method for treating an inflammatory, metabolic, fibrotic or cholestatic disease.
    11. Combination product for use according to claim 10, characterized by the fact that the fibrotic disorder is selected from the group consisting of fibrosis of the liver, kidney, skin, epidermis, endoderm, muscle, tendon, cartilage, heart, pancreas, lung, uterus, nervous system, testicles, penis, ovary, adrenal gland, artery, vein, colon, intestine (eg small intestine), biliary tract, soft tissue (eg mediastinum or retroperitoneum), marrow bone, joint or stomach fibrosis, in particular, liver, digestive tract, lung, heart, kidney, muscle, skin, soft tissue, bone marrow, intestinal, eye and joint.
    12. Combination product for use according to claim 10, characterized by the fact that the disease is selected from the group consisting of metabolic liver diseases, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH) , drug-induced liver disease, alcohol-induced liver disease, infectious agent-induced liver disease, inflammatory liver disease, immune-mediated liver disease, dyslipidemia, cardiovascular disease, restenosis, syndrome X, metabolic syndrome, diabetes, obesity, hypertension, chronic cholangiopathies such as Primary Sclerosing Cholangitis (PSC), Primary Biliary Cholangitis (PBC), biliary atresia, progressive family type intrahepatic cholestasis
    Petition 870190105365, of 10/18/2019, p. 126/148
    [7]
    7/7 chronic cholangiopathies such as Primary Sclerosing Cholangitis (PSC), Primary Biliary Cholangitis (PBC), biliary atresia, type 3 progressive familial intrahepatic cholestasis (PFIC3), inflammatory bowel disease, Crohn's disease, ulcerative colitis, liver cancer, carcinoma hepatocellular, gastrointestinal cancer, gastric cancer, colorectal cancer, fibrosis or liver cirrhosis induced by metabolic disease, NAFLD-induced fibrosis or cirrhosis, NASH-induced fibrosis or cirrhosis, alcohol-induced fibrosis or liver cirrhosis, infectious agent-induced liver fibrosis or cirrhosis, parasitic infection-induced liver fibrosis, fibrosis or liver cirrhosis induced by bacterial infection, fibrosis or cirrhosis induced by viral infection, fibrosis or liver cirrhosis induced by HBV infection, fibrosis or liver cirrhosis induced by HCV infection, fibrosis or liver cirrhosis induced by HI infection V, fibrosis or liver cirrhosis induced by double infection by HCV and HIV, fibrosis or cirrhosis induced by radiation or chemotherapy, fibrosis of the biliary tract, fibrosis or liver cirrhosis due to any chronic cholestatic disease, intestinal fibrosis of any etiology, disease-induced fibrosis Crohn's disease, fibrosis induced by ulcerative colitis, fibrosis of the intestine (eg small intestine), colon fibrosis, stomach fibrosis, pulmonary fibrosis, fibrosis following chronic inflammatory diseases of the airways, such as COPD, asthma, emphysema, lung smoker, tuberculosis, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF).
    类似技术:
    公开号 | 公开日 | 专利标题
    BR112019021910A2|2020-05-26|COMBINATION OF ELAFIBRANOR OR DERIVATIVES OF THE SAME WITH AN ANTI-NASH, ANTIFIBROTIC OR ANTICOLESTATIC AGENT
    JP2020514352A|2020-05-21|Pharmaceutical composition for combination therapy
    BR112019015406A2|2020-05-19|pharmaceutical compositions for combination therapy
    KR20190117632A|2019-10-16|Combination of PPAR agonist and FXR agonist
    KR101617584B1|2016-05-02|Pharmaceutical composition for prevention or treatment of peritoneal fibrosis
    JP2020510651A|2020-04-09|Pharmaceutical compositions for combination therapy
    KR20210150436A|2021-12-10|Combination therapy comprising a compound of formula | and a GLP-1 receptor agonist
    TW202135812A|2021-10-01|Combination treatment of liver diseases using integrin inhibitors
    同族专利:
    公开号 | 公开日
    EP3612176A1|2020-02-26|
    AU2018254743A1|2019-10-31|
    JP2020517612A|2020-06-18|
    BR112019021914A2|2020-05-26|
    CN110536683A|2019-12-03|
    US20200121625A1|2020-04-23|
    KR20190136079A|2019-12-09|
    US20200206169A1|2020-07-02|
    CA3057940A1|2018-10-25|
    AU2018253885A1|2019-11-14|
    JP2020517621A|2020-06-18|
    CA3058542A1|2018-10-25|
    IL269829D0|2019-11-28|
    SG11201909168VA|2019-11-28|
    WO2018193006A1|2018-10-25|
    PH12019502348A1|2020-12-07|
    CN110536682A|2019-12-03|
    EP3612175A1|2020-02-26|
    WO2018193007A1|2018-10-25|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    FR2841900B1|2002-07-08|2007-03-02|Genfit S A|NOVEL SUBSTITUTED 1,3-DIPHENYLPROP-2-EN-1-ONE DERIVATIVES, PREPARATION AND USES|
    EP2641596B1|2009-11-26|2018-05-02|Genfit|Use of 1,3-diphenylprop-2-en-1-one derivatives for treating liver disorders|
    LT2948137T|2013-01-18|2018-12-27|Genfit|Methods of treatment of fibrosis and cancers|
    EP3191100A4|2014-09-12|2018-05-30|Tobira Therapeutics, Inc.|Cenicriviroc combination therapy for the treatment of fibrosis|
    FR3027228B1|2014-10-20|2016-12-09|Valbiotis|COMPOSITION COMPRISING A MIXTURE OF PLANT EXTRACTS AND USE FOR ACTING ON GLUCIDIC AND / OR LIPID METABOLISM|
    SG11201705361PA|2015-01-09|2017-08-30|Gilead Apollo Llc|Acc inhibitor combination therapy for the treatment of non-alcoholic fatty liver disease|
    WO2016153948A1|2015-03-20|2016-09-29|Deuterx, Llc|Combination therapy using enantiopure, oxy-substituted, deuterium-enriched 5--5-deutero-thiazolidine-2, 4-diones for treatment of medical disorders|
    EP3273964A4|2015-03-26|2019-01-30|T3D Therapeutics Inc.|Methods of treating liver disease using indane acetic acid derivatives|EP1898926A2|2005-05-26|2008-03-19|Metabasis Therapeutics, Inc.|Thyromimetics for the treatment of fatty liver diseases|
    KR102051030B1|2011-10-28|2019-12-02|루메나 파마수티컬즈, 인코포레이티드|Bile acid recycling inhibitors for treatment of pediatric cholestatic liver diseases|
    EP3541395A4|2016-11-21|2020-07-01|Viking Therapeutics, Inc.|Method of treating glycogen storage disease|
    MX2019011867A|2017-04-03|2020-01-09|Coherus Biosciences Inc|Pparî³ agonist for treatment of progressive supranuclear palsy.|
    EP3890747A1|2018-12-05|2021-10-13|Viking Therapeutics, Inc.|Compositions for the treatment of fibrosis and inflammation|
    CN113365637A|2018-12-05|2021-09-07|维京治疗公司|Compositions and methods for treating liver disorders|
    WO2020167958A1|2019-02-12|2020-08-20|Mirum Pharmaceuticals, Inc.|Methods for treating cholestasis|
    EP3946335A1|2019-04-04|2022-02-09|Coherus Biosciences, Inc.|Compositions and methods to treat non-alcoholic fatty liver diseases |
    EP3952868A1|2019-04-09|2022-02-16|Genfit|Combination of nitazoxanide and elafibranor for the treatment of immune diseases or inflammation|
    KR20210150436A|2019-04-10|2021-12-10|장피트|Combination therapy comprising a compound of formulaand a GLP-1 receptor agonist|
    CA3139101A1|2019-05-08|2020-11-12|Aligos Therapeutics, Inc.|Modulators of thr-s and methods of use thereof|
    WO2021004736A1|2019-07-09|2021-01-14|Dsm Ip Assets B.V.|Reducing the viral activity of elafibranor with riboflavin or dha|
    WO2021210799A1|2020-04-13|2021-10-21|압타바이오 주식회사|Pulmonary fibrosis medicine containing pyrazole derivative|
    KR20210127085A|2020-04-13|2021-10-21|압타바이오 주식회사|composition of pyrazole derivatives for treatment of pulmonary fibrosis|
    CN112402431A|2020-12-20|2021-02-26|台州学院|New application of paricalcitol in preparation of medicine for treating cholestatic liver injury|
    法律状态:
    2021-10-19| B350| Update of information on the portal [chapter 15.35 patent gazette]|
    优先权:
    申请号 | 申请日 | 专利标题
    EP17305452|2017-04-18|
    EP17305452.9|2017-04-18|
    EP18305150|2018-02-13|
    EP18305150.7|2018-02-13|
    PCT/EP2018/059967|WO2018193006A1|2017-04-18|2018-04-18|Combination of elafibranor or derivatives thereof with an anti-nash, anti-fibrotic or anti-cholestatic agent|
    [返回顶部]